Incidental Mutation 'R6419:Lactb2'
ID517976
Institutional Source Beutler Lab
Gene Symbol Lactb2
Ensembl Gene ENSMUSG00000025937
Gene Namelactamase, beta 2
SynonymsE430032H21Rik, Cgi-83
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6419 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location13623330-13660546 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 13638235 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 196 (Y196*)
Ref Sequence ENSEMBL: ENSMUSP00000027071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027071]
Predicted Effect probably null
Transcript: ENSMUST00000027071
AA Change: Y196*
SMART Domains Protein: ENSMUSP00000027071
Gene: ENSMUSG00000025937
AA Change: Y196*

DomainStartEndE-ValueType
Lactamase_B 30 199 6.69e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194537
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 96% (67/70)
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele exhibit at 40 days of age preceeded by decreased body size, lethargy, enlarged and pale liver and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T C 4: 42,812,473 probably benign Het
Abcc2 T A 19: 43,837,508 probably null Het
Adamts12 C T 15: 11,215,673 T260M possibly damaging Het
Adamts20 C T 15: 94,333,675 V878I possibly damaging Het
Adgrl4 A G 3: 151,439,316 E34G probably damaging Het
Asah1 A T 8: 41,343,766 I293N probably damaging Het
B3galt2 A T 1: 143,647,101 E325V possibly damaging Het
Baz1b T A 5: 135,242,494 H1310Q probably benign Het
Ccdc125 T A 13: 100,690,326 N204K probably damaging Het
Cd36 C T 5: 17,797,152 D284N probably benign Het
Cdh12 T C 15: 21,520,397 L316S probably damaging Het
Cenpv T C 11: 62,525,182 K247R probably benign Het
Cldn18 T C 9: 99,692,748 H257R possibly damaging Het
Cnot8 T A 11: 58,114,065 Y197N probably damaging Het
Cog3 A T 14: 75,724,738 C554* probably null Het
Col4a4 A G 1: 82,466,486 probably null Het
Cops5 G A 1: 10,033,307 T158I probably damaging Het
Dhh A G 15: 98,894,401 F242S probably damaging Het
Dot1l T C 10: 80,791,481 V1512A possibly damaging Het
Dstn T G 2: 143,939,987 I116S possibly damaging Het
Egfem1 G A 3: 29,657,249 D326N probably damaging Het
Enpp3 A T 10: 24,808,191 Y52N probably damaging Het
Fam214a G A 9: 75,009,337 S413N probably benign Het
Gabra2 A G 5: 70,962,083 S359P probably benign Het
Gbp7 G A 3: 142,546,453 G599E probably benign Het
Gcat T G 15: 79,036,064 I198S probably damaging Het
Gm8439 A G 4: 120,609,558 K82R unknown Het
Grin2b A G 6: 135,740,967 F709S probably damaging Het
Grm3 T C 5: 9,570,201 N348D probably damaging Het
Hdgfl1 G A 13: 26,770,092 probably benign Het
Hmgxb3 G T 18: 61,152,224 D564E possibly damaging Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Impg1 A G 9: 80,380,018 V305A probably benign Het
Ints7 T A 1: 191,602,302 S313T possibly damaging Het
Knl1 T A 2: 119,069,003 I395K probably benign Het
Lad1 T C 1: 135,831,892 S509P possibly damaging Het
Ltf T C 9: 111,031,022 F504L possibly damaging Het
Med4 A T 14: 73,513,923 D104V probably damaging Het
Mrpl58 A T 11: 115,410,247 N128Y probably damaging Het
Ndufs2 T C 1: 171,241,099 T54A probably benign Het
Notch2 G T 3: 98,100,389 probably null Het
Ntng1 A T 3: 109,782,853 N424K possibly damaging Het
Ntrk2 G A 13: 58,861,299 W301* probably null Het
Olfr1471 T A 19: 13,445,767 S252T probably benign Het
Otud6b A G 4: 14,822,766 S113P possibly damaging Het
Papd7 A C 13: 69,510,666 M350R possibly damaging Het
Pcdhb20 A G 18: 37,505,555 N378S probably damaging Het
Polr3b T C 10: 84,638,111 S185P possibly damaging Het
Ptprn G A 1: 75,264,037 R31C probably benign Het
Rgsl1 C T 1: 153,822,371 V478M probably damaging Het
Sema6b A T 17: 56,132,784 L19* probably null Het
Slfn8 A G 11: 83,004,055 probably null Het
Spen A T 4: 141,476,310 S1669T unknown Het
Syne2 T C 12: 76,096,966 F1522L probably damaging Het
Tarbp1 C T 8: 126,459,044 A470T possibly damaging Het
Tiam1 C A 16: 89,898,024 E182* probably null Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trip12 C T 1: 84,793,870 A186T probably damaging Het
Ufc1 C T 1: 171,288,956 A147T probably damaging Het
Vmn1r199 A G 13: 22,383,607 K314R possibly damaging Het
Vmn2r13 A T 5: 109,175,219 I68K possibly damaging Het
Vmn2r77 A T 7: 86,811,559 I698F probably damaging Het
Vmn2r86 T C 10: 130,446,926 K607R probably damaging Het
Vwa3b T C 1: 37,157,376 V28A probably benign Het
Wdr19 A G 5: 65,215,893 N166S possibly damaging Het
Wfdc17 G A 11: 83,704,808 G33R probably damaging Het
Zfp330 T G 8: 82,764,916 K209N probably benign Het
Zfp493 A G 13: 67,786,407 T160A probably benign Het
Zfp974 A T 7: 27,911,515 C262S possibly damaging Het
Other mutations in Lactb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lactb2 APN 1 13660374 missense probably damaging 1.00
IGL00595:Lactb2 APN 1 13630126 missense probably benign 0.05
IGL00730:Lactb2 APN 1 13647516 splice site probably benign
R0371:Lactb2 UTSW 1 13650760 missense possibly damaging 0.69
R0782:Lactb2 UTSW 1 13647451 missense probably benign 0.18
R1670:Lactb2 UTSW 1 13660417 missense probably damaging 0.99
R2324:Lactb2 UTSW 1 13638296 missense probably damaging 1.00
R2418:Lactb2 UTSW 1 13660339 missense possibly damaging 0.93
R3500:Lactb2 UTSW 1 13660449 start codon destroyed probably null 1.00
R4345:Lactb2 UTSW 1 13660350 missense probably damaging 1.00
R4664:Lactb2 UTSW 1 13647400 missense probably damaging 1.00
R4665:Lactb2 UTSW 1 13647400 missense probably damaging 1.00
R4716:Lactb2 UTSW 1 13638395 missense probably damaging 1.00
R5363:Lactb2 UTSW 1 13630132 missense probably benign 0.22
R5658:Lactb2 UTSW 1 13627418 missense probably benign 0.03
R5734:Lactb2 UTSW 1 13660387 missense probably damaging 1.00
R5918:Lactb2 UTSW 1 13650730 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGCTGTCCGCTAAAGTCTGC -3'
(R):5'- TTGTACACTCCTGGCCACAC -3'

Sequencing Primer
(F):5'- GTCCGCTAAAGTCTGCTATATAATAC -3'
(R):5'- TGGCCACACTGATGATCACATG -3'
Posted On2018-05-24