Incidental Mutation 'R6418:Slc26a9'
ID518043
Institutional Source Beutler Lab
Gene Symbol Slc26a9
Ensembl Gene ENSMUSG00000042268
Gene Namesolute carrier family 26, member 9
Synonymsanion transporter/exchanger-9, E030002L01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock #R6418 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location131744022-131771504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 131758490 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 337 (C337F)
Ref Sequence ENSEMBL: ENSMUSP00000141171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049027] [ENSMUST00000147800] [ENSMUST00000186122]
Predicted Effect probably benign
Transcript: ENSMUST00000049027
AA Change: C374F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000036916
Gene: ENSMUSG00000042268
AA Change: C374F

DomainStartEndE-ValueType
Pfam:Sulfate_transp 71 469 7.4e-99 PFAM
transmembrane domain 473 495 N/A INTRINSIC
Pfam:STAS 520 733 2.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147800
SMART Domains Protein: ENSMUSP00000122075
Gene: ENSMUSG00000042268

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 56 139 5.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186122
AA Change: C337F

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141171
Gene: ENSMUSG00000042268
AA Change: C337F

DomainStartEndE-ValueType
Pfam:Sulfate_transp 150 428 9.6e-58 PFAM
low complexity region 453 462 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures yet have markedly different tissue expression patterns. The product of this gene is a highly selective chloride ion channel regulated by WNK kinases. Alternative splicing results in multiple transcript variants encoding differing isoforms.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced gastric secretory membranes and loss of gastric acid secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930507D05Rik C T 10: 62,449,662 A55V unknown Het
Adra1b T G 11: 43,776,201 D403A probably benign Het
Ankdd1b A T 13: 96,460,897 L9Q probably damaging Het
Ankrd17 A T 5: 90,278,345 S789R possibly damaging Het
B3galnt1 A G 3: 69,574,993 S312P probably damaging Het
C4bp C T 1: 130,656,013 V73M probably damaging Het
Cenpe T A 3: 135,251,544 N1854K probably damaging Het
Chrm2 A C 6: 36,523,739 Y177S probably damaging Het
Clca4b C T 3: 144,928,235 V140I probably benign Het
Csad A G 15: 102,179,523 S322P probably damaging Het
Depdc1b T G 13: 108,357,422 Y115D probably damaging Het
Dnah17 T C 11: 118,129,197 Y8C probably damaging Het
Dsg3 T C 18: 20,523,760 probably null Het
E330021D16Rik C A 6: 136,401,101 D244Y probably damaging Het
Elf5 A G 2: 103,439,352 T93A possibly damaging Het
Eogt C T 6: 97,145,392 D27N possibly damaging Het
Fam118b T C 9: 35,235,337 D78G probably damaging Het
Fam160b1 T A 19: 57,381,734 M470K probably benign Het
Frem3 A G 8: 80,611,152 T25A probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm6588 T C 5: 112,450,153 S189P probably benign Het
Golm1 T C 13: 59,665,561 Y32C probably damaging Het
Has1 A T 17: 17,849,945 V238E probably damaging Het
Hkdc1 T C 10: 62,383,804 R907G possibly damaging Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Krtap24-1 C T 16: 88,611,873 V122I probably damaging Het
Lrrc10 T G 10: 117,045,711 L97V probably damaging Het
Map3k20 T A 2: 72,402,113 M371K probably benign Het
Mis18bp1 A T 12: 65,158,543 M2K possibly damaging Het
Mob3b T A 4: 34,954,049 probably null Het
Muc4 A G 16: 32,751,789 T556A possibly damaging Het
Muc6 A C 7: 141,639,610 probably benign Het
Ncapg A T 5: 45,681,816 L519F probably damaging Het
Nfix A G 8: 84,727,149 S265P probably benign Het
Olfr1226 T C 2: 89,193,479 K185R probably damaging Het
Olfr1299 T C 2: 111,664,472 V82A probably benign Het
Olfr62 T A 4: 118,665,611 F31L possibly damaging Het
Olfr678 T C 7: 105,070,307 L280P probably damaging Het
Olfr955 C A 9: 39,469,816 K303N probably benign Het
Osgin2 T C 4: 16,006,410 T95A probably benign Het
Parp4 T C 14: 56,620,651 probably null Het
Pcdh7 G A 5: 57,721,704 G867D probably damaging Het
Pcdhb22 T C 18: 37,519,906 S476P possibly damaging Het
Phldb1 A G 9: 44,711,900 I619T probably damaging Het
Ppp1r13l C T 7: 19,371,331 R343C probably damaging Het
Rab2b T A 14: 52,268,707 probably benign Het
Rims2 A T 15: 39,509,696 E972V probably damaging Het
Spty2d1 A G 7: 46,998,003 S393P probably damaging Het
Stkld1 A T 2: 26,941,081 N90I possibly damaging Het
Svep1 T A 4: 58,053,126 R3406S probably benign Het
Svil A T 18: 5,040,171 D48V probably benign Het
Thsd7a T A 6: 12,555,082 K268* probably null Het
Tmc6 A G 11: 117,770,500 L618P probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Ubn1 A G 16: 5,081,927 H1101R probably benign Het
Upf2 G A 2: 6,027,339 V899I unknown Het
Ush2a A T 1: 188,628,566 N2161I probably damaging Het
Usp25 A T 16: 77,062,442 D276V probably damaging Het
Vmn2r68 T A 7: 85,233,707 H279L probably benign Het
Vps13d G A 4: 145,092,280 R3019W probably damaging Het
Vsig10 A T 5: 117,348,296 E423D probably benign Het
Wdfy2 T A 14: 62,925,133 F95I probably benign Het
Xrn1 A G 9: 96,033,710 probably null Het
Zdhhc13 A G 7: 48,811,401 T362A possibly damaging Het
Zfp984 C T 4: 147,761,246 S2N probably benign Het
Other mutations in Slc26a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Slc26a9 APN 1 131757528 missense probably damaging 0.97
IGL01131:Slc26a9 APN 1 131755542 splice site probably null
IGL01544:Slc26a9 APN 1 131759495 critical splice donor site probably null
IGL01845:Slc26a9 APN 1 131757518 missense probably damaging 0.99
IGL02125:Slc26a9 APN 1 131759437 missense probably damaging 1.00
IGL02151:Slc26a9 APN 1 131764043 missense probably damaging 1.00
IGL02267:Slc26a9 APN 1 131752845 missense probably damaging 1.00
IGL02469:Slc26a9 APN 1 131762936 missense probably damaging 0.96
IGL03137:Slc26a9 APN 1 131763877 missense probably benign 0.01
IGL03324:Slc26a9 APN 1 131764010 missense probably damaging 1.00
R0588:Slc26a9 UTSW 1 131754011 splice site probably benign
R0611:Slc26a9 UTSW 1 131762761 missense probably damaging 1.00
R0639:Slc26a9 UTSW 1 131763804 missense probably damaging 0.97
R0654:Slc26a9 UTSW 1 131765030 missense probably benign 0.00
R0926:Slc26a9 UTSW 1 131753216 missense probably benign 0.40
R1109:Slc26a9 UTSW 1 131758798 missense probably benign 0.05
R1521:Slc26a9 UTSW 1 131750677 missense probably damaging 1.00
R1728:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1728:Slc26a9 UTSW 1 131766012 missense probably benign
R1729:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1729:Slc26a9 UTSW 1 131766012 missense probably benign
R1730:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1739:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131766012 missense probably benign
R1783:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1783:Slc26a9 UTSW 1 131766012 missense probably benign
R1784:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1784:Slc26a9 UTSW 1 131766012 missense probably benign
R1785:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1785:Slc26a9 UTSW 1 131766012 missense probably benign
R1992:Slc26a9 UTSW 1 131762794 missense probably damaging 1.00
R2198:Slc26a9 UTSW 1 131763263 splice site probably benign
R3008:Slc26a9 UTSW 1 131765914 missense probably damaging 1.00
R3409:Slc26a9 UTSW 1 131763944 missense probably benign
R3879:Slc26a9 UTSW 1 131769231 missense probably benign 0.39
R4064:Slc26a9 UTSW 1 131763187 missense probably benign 0.01
R4088:Slc26a9 UTSW 1 131767849 missense possibly damaging 0.49
R4657:Slc26a9 UTSW 1 131753138 missense probably damaging 1.00
R5005:Slc26a9 UTSW 1 131765887 missense probably damaging 0.99
R6255:Slc26a9 UTSW 1 131763909 missense probably benign 0.00
R6442:Slc26a9 UTSW 1 131758817 missense possibly damaging 0.58
R6674:Slc26a9 UTSW 1 131765018 missense probably benign 0.01
R6719:Slc26a9 UTSW 1 131761785 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGGCTAGCCTTTTGAGTGC -3'
(R):5'- CCAGCTGATCATTGGGTAGAATG -3'

Sequencing Primer
(F):5'- AGGCTAGCCTTTTGAGTGCTTATG -3'
(R):5'- TCATTGGGTAGAATGGAAGCTAGCTG -3'
Posted On2018-05-24