Incidental Mutation 'R6418:Clca4b'
ID518053
Institutional Source Beutler Lab
Gene Symbol Clca4b
Ensembl Gene ENSMUSG00000074195
Gene Namechloride channel accessory 4B
SynonymsAI747448
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6418 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location144910921-144932529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 144928235 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 140 (V140I)
Ref Sequence ENSEMBL: ENSMUSP00000096149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098549]
Predicted Effect probably benign
Transcript: ENSMUST00000098549
AA Change: V140I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000096149
Gene: ENSMUSG00000074195
AA Change: V140I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 306 480 1.03e-15 SMART
Blast:VWA 513 552 6e-16 BLAST
Blast:FN3 757 838 5e-35 BLAST
low complexity region 882 906 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: No notable phenotype was detected in a high throughput screen of homozyogus mutant null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930507D05Rik C T 10: 62,449,662 A55V unknown Het
Adra1b T G 11: 43,776,201 D403A probably benign Het
Ankdd1b A T 13: 96,460,897 L9Q probably damaging Het
Ankrd17 A T 5: 90,278,345 S789R possibly damaging Het
B3galnt1 A G 3: 69,574,993 S312P probably damaging Het
C4bp C T 1: 130,656,013 V73M probably damaging Het
Cenpe T A 3: 135,251,544 N1854K probably damaging Het
Chrm2 A C 6: 36,523,739 Y177S probably damaging Het
Csad A G 15: 102,179,523 S322P probably damaging Het
Depdc1b T G 13: 108,357,422 Y115D probably damaging Het
Dnah17 T C 11: 118,129,197 Y8C probably damaging Het
Dsg3 T C 18: 20,523,760 probably null Het
E330021D16Rik C A 6: 136,401,101 D244Y probably damaging Het
Elf5 A G 2: 103,439,352 T93A possibly damaging Het
Eogt C T 6: 97,145,392 D27N possibly damaging Het
Fam118b T C 9: 35,235,337 D78G probably damaging Het
Fam160b1 T A 19: 57,381,734 M470K probably benign Het
Frem3 A G 8: 80,611,152 T25A probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm6588 T C 5: 112,450,153 S189P probably benign Het
Golm1 T C 13: 59,665,561 Y32C probably damaging Het
Has1 A T 17: 17,849,945 V238E probably damaging Het
Hkdc1 T C 10: 62,383,804 R907G possibly damaging Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Krtap24-1 C T 16: 88,611,873 V122I probably damaging Het
Lrrc10 T G 10: 117,045,711 L97V probably damaging Het
Map3k20 T A 2: 72,402,113 M371K probably benign Het
Mis18bp1 A T 12: 65,158,543 M2K possibly damaging Het
Mob3b T A 4: 34,954,049 probably null Het
Muc4 A G 16: 32,751,789 T556A possibly damaging Het
Muc6 A C 7: 141,639,610 probably benign Het
Ncapg A T 5: 45,681,816 L519F probably damaging Het
Nfix A G 8: 84,727,149 S265P probably benign Het
Olfr1226 T C 2: 89,193,479 K185R probably damaging Het
Olfr1299 T C 2: 111,664,472 V82A probably benign Het
Olfr62 T A 4: 118,665,611 F31L possibly damaging Het
Olfr678 T C 7: 105,070,307 L280P probably damaging Het
Olfr955 C A 9: 39,469,816 K303N probably benign Het
Osgin2 T C 4: 16,006,410 T95A probably benign Het
Parp4 T C 14: 56,620,651 probably null Het
Pcdh7 G A 5: 57,721,704 G867D probably damaging Het
Pcdhb22 T C 18: 37,519,906 S476P possibly damaging Het
Phldb1 A G 9: 44,711,900 I619T probably damaging Het
Ppp1r13l C T 7: 19,371,331 R343C probably damaging Het
Rab2b T A 14: 52,268,707 probably benign Het
Rims2 A T 15: 39,509,696 E972V probably damaging Het
Slc26a9 G T 1: 131,758,490 C337F probably benign Het
Spty2d1 A G 7: 46,998,003 S393P probably damaging Het
Stkld1 A T 2: 26,941,081 N90I possibly damaging Het
Svep1 T A 4: 58,053,126 R3406S probably benign Het
Svil A T 18: 5,040,171 D48V probably benign Het
Thsd7a T A 6: 12,555,082 K268* probably null Het
Tmc6 A G 11: 117,770,500 L618P probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Ubn1 A G 16: 5,081,927 H1101R probably benign Het
Upf2 G A 2: 6,027,339 V899I unknown Het
Ush2a A T 1: 188,628,566 N2161I probably damaging Het
Usp25 A T 16: 77,062,442 D276V probably damaging Het
Vmn2r68 T A 7: 85,233,707 H279L probably benign Het
Vps13d G A 4: 145,092,280 R3019W probably damaging Het
Vsig10 A T 5: 117,348,296 E423D probably benign Het
Wdfy2 T A 14: 62,925,133 F95I probably benign Het
Xrn1 A G 9: 96,033,710 probably null Het
Zdhhc13 A G 7: 48,811,401 T362A possibly damaging Het
Zfp984 C T 4: 147,761,246 S2N probably benign Het
Other mutations in Clca4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Clca4b APN 3 144932391 missense probably benign 0.00
IGL00391:Clca4b APN 3 144915561 missense possibly damaging 0.81
IGL00576:Clca4b APN 3 144925347 missense probably damaging 1.00
IGL01484:Clca4b APN 3 144928235 missense probably benign 0.02
IGL01539:Clca4b APN 3 144926157 missense probably benign
IGL01726:Clca4b APN 3 144928342 missense probably damaging 1.00
IGL01903:Clca4b APN 3 144928259 missense probably damaging 0.98
IGL01967:Clca4b APN 3 144928190 splice site probably benign
IGL02002:Clca4b APN 3 144932433 missense probably benign 0.00
IGL02323:Clca4b APN 3 144913321 missense probably benign
IGL02379:Clca4b APN 3 144921858 missense probably benign 0.00
IGL02638:Clca4b APN 3 144926178 missense probably damaging 1.00
IGL02859:Clca4b APN 3 144912039 missense probably benign
R0110:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0266:Clca4b UTSW 3 144922786 missense probably damaging 1.00
R0311:Clca4b UTSW 3 144932496 missense probably benign 0.04
R0348:Clca4b UTSW 3 144921980 missense probably damaging 0.96
R0450:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0510:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0538:Clca4b UTSW 3 144921956 missense probably benign 0.15
R0551:Clca4b UTSW 3 144928626 missense probably damaging 1.00
R0552:Clca4b UTSW 3 144916775 missense probably benign
R0570:Clca4b UTSW 3 144925349 missense probably benign 0.01
R0591:Clca4b UTSW 3 144915592 nonsense probably null
R0627:Clca4b UTSW 3 144928259 missense probably benign 0.20
R0729:Clca4b UTSW 3 144928350 splice site probably benign
R0844:Clca4b UTSW 3 144916771 missense probably damaging 0.96
R0964:Clca4b UTSW 3 144915576 missense probably benign
R1388:Clca4b UTSW 3 144916654 missense probably benign
R1479:Clca4b UTSW 3 144915468 missense probably damaging 0.99
R1603:Clca4b UTSW 3 144922019 missense probably benign 0.20
R2045:Clca4b UTSW 3 144925163 missense probably damaging 1.00
R2162:Clca4b UTSW 3 144928587 missense probably benign 0.19
R2185:Clca4b UTSW 3 144928556 missense probably damaging 1.00
R2241:Clca4b UTSW 3 144911226 missense probably benign 0.00
R2300:Clca4b UTSW 3 144916671 missense probably benign 0.02
R2321:Clca4b UTSW 3 144932373 missense probably benign 0.00
R2359:Clca4b UTSW 3 144925242 missense probably damaging 0.96
R3105:Clca4b UTSW 3 144916671 missense probably benign 0.02
R3151:Clca4b UTSW 3 144915511 missense probably benign 0.05
R3158:Clca4b UTSW 3 144912117 missense probably benign 0.04
R3177:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3277:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3981:Clca4b UTSW 3 144926036 missense probably benign 0.27
R4601:Clca4b UTSW 3 144927184 missense possibly damaging 0.81
R4646:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4647:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4696:Clca4b UTSW 3 144911385 missense probably benign 0.00
R4893:Clca4b UTSW 3 144925173 missense possibly damaging 0.67
R4998:Clca4b UTSW 3 144915508 missense probably benign 0.00
R5053:Clca4b UTSW 3 144911121 missense probably benign 0.01
R5060:Clca4b UTSW 3 144911506 missense probably damaging 1.00
R5319:Clca4b UTSW 3 144925179 missense possibly damaging 0.85
R5409:Clca4b UTSW 3 144916691 nonsense probably null
R5534:Clca4b UTSW 3 144915466 missense probably damaging 1.00
R5578:Clca4b UTSW 3 144932435 missense probably benign 0.04
R5667:Clca4b UTSW 3 144921863 missense probably benign
R5671:Clca4b UTSW 3 144921863 missense probably benign
R5715:Clca4b UTSW 3 144913257 missense probably benign 0.01
R5875:Clca4b UTSW 3 144922889 missense probably benign 0.38
R5876:Clca4b UTSW 3 144912060 missense possibly damaging 0.91
R6122:Clca4b UTSW 3 144926166 missense possibly damaging 0.67
R6294:Clca4b UTSW 3 144925185 missense probably null
R6408:Clca4b UTSW 3 144919275 missense probably benign 0.00
R6458:Clca4b UTSW 3 144911327 missense possibly damaging 0.77
R6536:Clca4b UTSW 3 144916729 missense possibly damaging 0.66
R6567:Clca4b UTSW 3 144932339 missense possibly damaging 0.96
R6781:Clca4b UTSW 3 144922801 missense probably benign
R6799:Clca4b UTSW 3 144915627 splice site probably null
R7046:Clca4b UTSW 3 144915606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTAGTGCATCAAGAATTTG -3'
(R):5'- AGTTCCCAGTACAGAAGGCC -3'

Sequencing Primer
(F):5'- GTGCATCAAGAATTTGTTGAATTTTG -3'
(R):5'- AAAAGTATTTTCTGGTGCTTGCTAG -3'
Posted On2018-05-24