Incidental Mutation 'R6418:Fam118b'
ID518078
Institutional Source Beutler Lab
Gene Symbol Fam118b
Ensembl Gene ENSMUSG00000050471
Gene Namefamily with sequence similarity 118, member B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R6418 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location35216965-35267805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35235337 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 78 (D78G)
Ref Sequence ENSEMBL: ENSMUSP00000113537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059057] [ENSMUST00000063782] [ENSMUST00000121564] [ENSMUST00000125087] [ENSMUST00000132799] [ENSMUST00000214230] [ENSMUST00000217306]
Predicted Effect probably damaging
Transcript: ENSMUST00000059057
AA Change: D78G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058377
Gene: ENSMUSG00000050471
AA Change: D78G

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 1.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063782
AA Change: D78G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066281
Gene: ENSMUSG00000050471
AA Change: D78G

DomainStartEndE-ValueType
Pfam:SIR2_2 75 225 7.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121564
AA Change: D78G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113537
Gene: ENSMUSG00000050471
AA Change: D78G

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 2.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125087
AA Change: D78G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119747
Gene: ENSMUSG00000050471
AA Change: D78G

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 268 3.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132799
SMART Domains Protein: ENSMUSP00000115104
Gene: ENSMUSG00000032042

DomainStartEndE-ValueType
Pfam:SRP54 3 132 8.6e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000133739
AA Change: D36G
SMART Domains Protein: ENSMUSP00000121690
Gene: ENSMUSG00000050471
AA Change: D36G

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147256
Predicted Effect probably benign
Transcript: ENSMUST00000214230
Predicted Effect probably benign
Transcript: ENSMUST00000217306
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930507D05Rik C T 10: 62,449,662 A55V unknown Het
Adra1b T G 11: 43,776,201 D403A probably benign Het
Ankdd1b A T 13: 96,460,897 L9Q probably damaging Het
Ankrd17 A T 5: 90,278,345 S789R possibly damaging Het
B3galnt1 A G 3: 69,574,993 S312P probably damaging Het
C4bp C T 1: 130,656,013 V73M probably damaging Het
Cenpe T A 3: 135,251,544 N1854K probably damaging Het
Chrm2 A C 6: 36,523,739 Y177S probably damaging Het
Clca4b C T 3: 144,928,235 V140I probably benign Het
Csad A G 15: 102,179,523 S322P probably damaging Het
Depdc1b T G 13: 108,357,422 Y115D probably damaging Het
Dnah17 T C 11: 118,129,197 Y8C probably damaging Het
Dsg3 T C 18: 20,523,760 probably null Het
E330021D16Rik C A 6: 136,401,101 D244Y probably damaging Het
Elf5 A G 2: 103,439,352 T93A possibly damaging Het
Eogt C T 6: 97,145,392 D27N possibly damaging Het
Fam160b1 T A 19: 57,381,734 M470K probably benign Het
Frem3 A G 8: 80,611,152 T25A probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm6588 T C 5: 112,450,153 S189P probably benign Het
Golm1 T C 13: 59,665,561 Y32C probably damaging Het
Has1 A T 17: 17,849,945 V238E probably damaging Het
Hkdc1 T C 10: 62,383,804 R907G possibly damaging Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Krtap24-1 C T 16: 88,611,873 V122I probably damaging Het
Lrrc10 T G 10: 117,045,711 L97V probably damaging Het
Map3k20 T A 2: 72,402,113 M371K probably benign Het
Mis18bp1 A T 12: 65,158,543 M2K possibly damaging Het
Mob3b T A 4: 34,954,049 probably null Het
Muc4 A G 16: 32,751,789 T556A possibly damaging Het
Muc6 A C 7: 141,639,610 probably benign Het
Ncapg A T 5: 45,681,816 L519F probably damaging Het
Nfix A G 8: 84,727,149 S265P probably benign Het
Olfr1226 T C 2: 89,193,479 K185R probably damaging Het
Olfr1299 T C 2: 111,664,472 V82A probably benign Het
Olfr62 T A 4: 118,665,611 F31L possibly damaging Het
Olfr678 T C 7: 105,070,307 L280P probably damaging Het
Olfr955 C A 9: 39,469,816 K303N probably benign Het
Osgin2 T C 4: 16,006,410 T95A probably benign Het
Parp4 T C 14: 56,620,651 probably null Het
Pcdh7 G A 5: 57,721,704 G867D probably damaging Het
Pcdhb22 T C 18: 37,519,906 S476P possibly damaging Het
Phldb1 A G 9: 44,711,900 I619T probably damaging Het
Ppp1r13l C T 7: 19,371,331 R343C probably damaging Het
Rab2b T A 14: 52,268,707 probably benign Het
Rims2 A T 15: 39,509,696 E972V probably damaging Het
Slc26a9 G T 1: 131,758,490 C337F probably benign Het
Spty2d1 A G 7: 46,998,003 S393P probably damaging Het
Stkld1 A T 2: 26,941,081 N90I possibly damaging Het
Svep1 T A 4: 58,053,126 R3406S probably benign Het
Svil A T 18: 5,040,171 D48V probably benign Het
Thsd7a T A 6: 12,555,082 K268* probably null Het
Tmc6 A G 11: 117,770,500 L618P probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Ubn1 A G 16: 5,081,927 H1101R probably benign Het
Upf2 G A 2: 6,027,339 V899I unknown Het
Ush2a A T 1: 188,628,566 N2161I probably damaging Het
Usp25 A T 16: 77,062,442 D276V probably damaging Het
Vmn2r68 T A 7: 85,233,707 H279L probably benign Het
Vps13d G A 4: 145,092,280 R3019W probably damaging Het
Vsig10 A T 5: 117,348,296 E423D probably benign Het
Wdfy2 T A 14: 62,925,133 F95I probably benign Het
Xrn1 A G 9: 96,033,710 probably null Het
Zdhhc13 A G 7: 48,811,401 T362A possibly damaging Het
Zfp984 C T 4: 147,761,246 S2N probably benign Het
Other mutations in Fam118b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1220:Fam118b UTSW 9 35223673 missense possibly damaging 0.82
R1293:Fam118b UTSW 9 35221425 missense probably damaging 1.00
R2079:Fam118b UTSW 9 35223664 missense possibly damaging 0.91
R4660:Fam118b UTSW 9 35235255 missense possibly damaging 0.86
R7000:Fam118b UTSW 9 35235264 missense probably damaging 1.00
R7016:Fam118b UTSW 9 35223718 missense probably damaging 1.00
R7095:Fam118b UTSW 9 35221490 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCTACTTTTCAGAAGAGCCAAATG -3'
(R):5'- TCGCATGTGCTTGGGTCTAC -3'

Sequencing Primer
(F):5'- GAGCCAAATGTTATAAATACACAGC -3'
(R):5'- CATGTGCTTGGGTCTACTGGAC -3'
Posted On2018-05-24