Incidental Mutation 'R6418:Mis18bp1'
ID518088
Institutional Source Beutler Lab
Gene Symbol Mis18bp1
Ensembl Gene ENSMUSG00000047534
Gene NameMIS18 binding protein 1
SynonymsC79407
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R6418 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location65132734-65172604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65158543 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 2 (M2K)
Ref Sequence ENSEMBL: ENSMUSP00000152132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052201] [ENSMUST00000124201] [ENSMUST00000221296] [ENSMUST00000222244]
Predicted Effect probably benign
Transcript: ENSMUST00000052201
AA Change: M285K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000052109
Gene: ENSMUSG00000047534
AA Change: M285K

DomainStartEndE-ValueType
low complexity region 319 332 N/A INTRINSIC
Pfam:SANTA 336 425 1.4e-27 PFAM
coiled coil region 428 448 N/A INTRINSIC
coiled coil region 645 668 N/A INTRINSIC
SANT 742 794 9.48e-6 SMART
low complexity region 874 884 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124201
AA Change: M2K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149986
Predicted Effect possibly damaging
Transcript: ENSMUST00000221296
AA Change: M2K

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000222244
AA Change: M285K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930507D05Rik C T 10: 62,449,662 A55V unknown Het
Adra1b T G 11: 43,776,201 D403A probably benign Het
Ankdd1b A T 13: 96,460,897 L9Q probably damaging Het
Ankrd17 A T 5: 90,278,345 S789R possibly damaging Het
B3galnt1 A G 3: 69,574,993 S312P probably damaging Het
C4bp C T 1: 130,656,013 V73M probably damaging Het
Cenpe T A 3: 135,251,544 N1854K probably damaging Het
Chrm2 A C 6: 36,523,739 Y177S probably damaging Het
Clca4b C T 3: 144,928,235 V140I probably benign Het
Csad A G 15: 102,179,523 S322P probably damaging Het
Depdc1b T G 13: 108,357,422 Y115D probably damaging Het
Dnah17 T C 11: 118,129,197 Y8C probably damaging Het
Dsg3 T C 18: 20,523,760 probably null Het
E330021D16Rik C A 6: 136,401,101 D244Y probably damaging Het
Elf5 A G 2: 103,439,352 T93A possibly damaging Het
Eogt C T 6: 97,145,392 D27N possibly damaging Het
Fam118b T C 9: 35,235,337 D78G probably damaging Het
Fam160b1 T A 19: 57,381,734 M470K probably benign Het
Frem3 A G 8: 80,611,152 T25A probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm6588 T C 5: 112,450,153 S189P probably benign Het
Golm1 T C 13: 59,665,561 Y32C probably damaging Het
Has1 A T 17: 17,849,945 V238E probably damaging Het
Hkdc1 T C 10: 62,383,804 R907G possibly damaging Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Krtap24-1 C T 16: 88,611,873 V122I probably damaging Het
Lrrc10 T G 10: 117,045,711 L97V probably damaging Het
Map3k20 T A 2: 72,402,113 M371K probably benign Het
Mob3b T A 4: 34,954,049 probably null Het
Muc4 A G 16: 32,751,789 T556A possibly damaging Het
Muc6 A C 7: 141,639,610 probably benign Het
Ncapg A T 5: 45,681,816 L519F probably damaging Het
Nfix A G 8: 84,727,149 S265P probably benign Het
Olfr1226 T C 2: 89,193,479 K185R probably damaging Het
Olfr1299 T C 2: 111,664,472 V82A probably benign Het
Olfr62 T A 4: 118,665,611 F31L possibly damaging Het
Olfr678 T C 7: 105,070,307 L280P probably damaging Het
Olfr955 C A 9: 39,469,816 K303N probably benign Het
Osgin2 T C 4: 16,006,410 T95A probably benign Het
Parp4 T C 14: 56,620,651 probably null Het
Pcdh7 G A 5: 57,721,704 G867D probably damaging Het
Pcdhb22 T C 18: 37,519,906 S476P possibly damaging Het
Phldb1 A G 9: 44,711,900 I619T probably damaging Het
Ppp1r13l C T 7: 19,371,331 R343C probably damaging Het
Rab2b T A 14: 52,268,707 probably benign Het
Rims2 A T 15: 39,509,696 E972V probably damaging Het
Slc26a9 G T 1: 131,758,490 C337F probably benign Het
Spty2d1 A G 7: 46,998,003 S393P probably damaging Het
Stkld1 A T 2: 26,941,081 N90I possibly damaging Het
Svep1 T A 4: 58,053,126 R3406S probably benign Het
Svil A T 18: 5,040,171 D48V probably benign Het
Thsd7a T A 6: 12,555,082 K268* probably null Het
Tmc6 A G 11: 117,770,500 L618P probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Ubn1 A G 16: 5,081,927 H1101R probably benign Het
Upf2 G A 2: 6,027,339 V899I unknown Het
Ush2a A T 1: 188,628,566 N2161I probably damaging Het
Usp25 A T 16: 77,062,442 D276V probably damaging Het
Vmn2r68 T A 7: 85,233,707 H279L probably benign Het
Vps13d G A 4: 145,092,280 R3019W probably damaging Het
Vsig10 A T 5: 117,348,296 E423D probably benign Het
Wdfy2 T A 14: 62,925,133 F95I probably benign Het
Xrn1 A G 9: 96,033,710 probably null Het
Zdhhc13 A G 7: 48,811,401 T362A possibly damaging Het
Zfp984 C T 4: 147,761,246 S2N probably benign Het
Other mutations in Mis18bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Mis18bp1 APN 12 65158441 missense possibly damaging 0.68
IGL01383:Mis18bp1 APN 12 65148989 missense probably benign 0.05
IGL01736:Mis18bp1 APN 12 65138678 missense probably damaging 1.00
IGL02037:Mis18bp1 APN 12 65136748 critical splice donor site probably null
IGL02210:Mis18bp1 APN 12 65136831 nonsense probably null
IGL02318:Mis18bp1 APN 12 65158741 missense probably benign 0.04
IGL02541:Mis18bp1 APN 12 65161460 missense probably damaging 0.97
IGL02664:Mis18bp1 APN 12 65153880 nonsense probably null
IGL02838:Mis18bp1 APN 12 65136826 missense probably damaging 0.99
IGL03031:Mis18bp1 APN 12 65161930 missense probably benign
PIT4453001:Mis18bp1 UTSW 12 65158673 missense probably damaging 0.98
R0555:Mis18bp1 UTSW 12 65161453 missense possibly damaging 0.94
R1169:Mis18bp1 UTSW 12 65143283 nonsense probably null
R1517:Mis18bp1 UTSW 12 65133813 missense probably benign 0.03
R1702:Mis18bp1 UTSW 12 65161744 missense probably benign
R1705:Mis18bp1 UTSW 12 65149339 missense probably benign 0.19
R1888:Mis18bp1 UTSW 12 65149328 missense probably benign 0.01
R1888:Mis18bp1 UTSW 12 65149328 missense probably benign 0.01
R1973:Mis18bp1 UTSW 12 65149076 nonsense probably null
R1990:Mis18bp1 UTSW 12 65158694 missense probably benign 0.03
R2023:Mis18bp1 UTSW 12 65149109 missense probably damaging 0.97
R2043:Mis18bp1 UTSW 12 65149418 missense probably damaging 1.00
R2318:Mis18bp1 UTSW 12 65140843 missense possibly damaging 0.92
R2897:Mis18bp1 UTSW 12 65133586 missense probably benign 0.09
R3120:Mis18bp1 UTSW 12 65156988 splice site probably null
R3845:Mis18bp1 UTSW 12 65149142 missense possibly damaging 0.61
R4578:Mis18bp1 UTSW 12 65153881 missense probably damaging 1.00
R4590:Mis18bp1 UTSW 12 65158506 missense possibly damaging 0.50
R4614:Mis18bp1 UTSW 12 65153529 intron probably benign
R4626:Mis18bp1 UTSW 12 65140766 missense probably damaging 1.00
R4724:Mis18bp1 UTSW 12 65158739 missense probably benign 0.18
R4873:Mis18bp1 UTSW 12 65161435 missense probably benign 0.23
R4875:Mis18bp1 UTSW 12 65161435 missense probably benign 0.23
R5173:Mis18bp1 UTSW 12 65149375 missense possibly damaging 0.96
R5294:Mis18bp1 UTSW 12 65157043 missense probably damaging 1.00
R5540:Mis18bp1 UTSW 12 65148746 missense possibly damaging 0.83
R5560:Mis18bp1 UTSW 12 65152816 missense possibly damaging 0.83
R5584:Mis18bp1 UTSW 12 65154776 missense probably damaging 0.98
R5661:Mis18bp1 UTSW 12 65148852 missense probably benign 0.41
R6235:Mis18bp1 UTSW 12 65158408 missense probably damaging 0.99
R6282:Mis18bp1 UTSW 12 65149163 missense probably benign 0.01
R6284:Mis18bp1 UTSW 12 65138787 missense probably benign 0.32
R6378:Mis18bp1 UTSW 12 65149247 missense probably benign 0.11
R7103:Mis18bp1 UTSW 12 65149283 missense possibly damaging 0.61
X0058:Mis18bp1 UTSW 12 65149226 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATACTTGCCTTAAAGGTCTTCCTAC -3'
(R):5'- AGTTTGGCGGACAAGTTCTTC -3'

Sequencing Primer
(F):5'- ACCGGCCAGATAGTGTTA -3'
(R):5'- GGCGGACAAGTTCTTCATTCAAAAG -3'
Posted On2018-05-24