Incidental Mutation 'R6420:Asb13'
ID518160
Institutional Source Beutler Lab
Gene Symbol Asb13
Ensembl Gene ENSMUSG00000033781
Gene Nameankyrin repeat and SOCS box-containing 13
Synonyms6430573K02Rik, 2210015B19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6420 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location3634032-3653822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3643574 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 111 (V111I)
Ref Sequence ENSEMBL: ENSMUSP00000046476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042288]
Predicted Effect probably damaging
Transcript: ENSMUST00000042288
AA Change: V111I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046476
Gene: ENSMUSG00000033781
AA Change: V111I

DomainStartEndE-ValueType
ANK 18 47 1.25e2 SMART
ANK 51 80 3.91e-3 SMART
ANK 84 113 1.53e-5 SMART
ANK 116 145 3.71e-4 SMART
ANK 149 178 6.65e-6 SMART
ANK 181 210 6.92e-4 SMART
SOCS_box 239 278 2.43e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157850
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants, both protein-coding and not protein-coding, have been described for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,398 I117N probably damaging Het
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Dhx16 A G 17: 35,883,014 E367G possibly damaging Het
Epc2 T C 2: 49,451,900 V32A probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hdlbp T C 1: 93,431,004 E275G probably damaging Het
Kdm7a T C 6: 39,165,168 D392G probably damaging Het
Lgmn T A 12: 102,423,719 R4* probably null Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Mup1 C G 4: 60,501,759 E31Q possibly damaging Het
Nckap1l G C 15: 103,491,466 G1025A possibly damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pik3r5 G A 11: 68,475,424 W42* probably null Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Rad1 T C 15: 10,488,012 V74A probably benign Het
Scara3 C T 14: 65,938,252 G22D possibly damaging Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Sema5b T A 16: 35,663,146 D1051E probably benign Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Spag9 T C 11: 94,086,302 V78A probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Zfp62 A T 11: 49,216,513 N477I probably damaging Het
Zfp846 T C 9: 20,593,711 L289P probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Asb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Asb13 APN 13 3643476 missense probably null 1.00
IGL00929:Asb13 APN 13 3649427 missense probably damaging 1.00
IGL01533:Asb13 APN 13 3642164 missense probably benign 0.05
R0654:Asb13 UTSW 13 3642092 missense probably damaging 1.00
R0694:Asb13 UTSW 13 3649480 missense probably benign 0.16
R0883:Asb13 UTSW 13 3645052 critical splice donor site probably null
R2014:Asb13 UTSW 13 3649512 critical splice donor site probably null
R2290:Asb13 UTSW 13 3649418 missense probably damaging 1.00
R4320:Asb13 UTSW 13 3645012 missense possibly damaging 0.69
R4322:Asb13 UTSW 13 3645012 missense possibly damaging 0.69
R4324:Asb13 UTSW 13 3645012 missense possibly damaging 0.69
R4895:Asb13 UTSW 13 3643589 missense probably damaging 0.99
R5305:Asb13 UTSW 13 3643479 missense probably damaging 1.00
R6417:Asb13 UTSW 13 3643574 missense probably damaging 1.00
R6813:Asb13 UTSW 13 3645029 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGTTTCAGACCAGTGAAC -3'
(R):5'- AGAACCAAGAGATTGTACTGGTTC -3'

Sequencing Primer
(F):5'- ATCTTTGCAATGATGGACCTGC -3'
(R):5'- GTACTGGTTCTATCTACTGGTGACAC -3'
Posted On2018-05-24