Incidental Mutation 'R6422:Gatsl2'
ID518207
Institutional Source Beutler Lab
Gene Symbol Gatsl2
Ensembl Gene ENSMUSG00000015944
Gene NameGATS protein-like 2
SynonymsGats
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R6422 (G1)
Quality Score165.009
Status Validated
Chromosome5
Chromosomal Location134099711-134144343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134135710 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 170 (M170K)
Ref Sequence ENSEMBL: ENSMUSP00000016088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016088]
Predicted Effect probably benign
Transcript: ENSMUST00000016088
AA Change: M170K

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000016088
Gene: ENSMUSG00000015944
AA Change: M170K

DomainStartEndE-ValueType
Pfam:ACT_7 71 141 9.4e-22 PFAM
Pfam:ACT_7 259 323 1.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201013
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik T A 4: 153,960,924 F137I probably damaging Het
Adam11 A G 11: 102,774,283 K417R possibly damaging Het
Btbd9 G A 17: 30,530,256 A28V probably benign Het
Cabin1 A G 10: 75,656,792 Y1890H probably damaging Het
Cep162 G T 9: 87,232,016 N334K possibly damaging Het
Cep85l A T 10: 53,291,780 M634K possibly damaging Het
Col20a1 C A 2: 181,014,819 T1161N possibly damaging Het
Dip2b T A 15: 100,199,011 D1155E probably damaging Het
Dlst T A 12: 85,130,885 probably null Het
Dsc1 A C 18: 20,095,033 L422R probably damaging Het
Gcn1l1 T C 5: 115,609,544 W1699R probably damaging Het
Gm14443 G A 2: 175,170,381 Q91* probably null Het
Gm8159 T C 14: 4,635,211 I143T probably damaging Het
Il4i1 G T 7: 44,840,136 A442S probably damaging Het
Kif26a T G 12: 112,168,875 L337R possibly damaging Het
Lat2 T C 5: 134,603,161 D144G probably benign Het
Ndst1 G T 18: 60,702,953 H419Q probably benign Het
Notch4 T C 17: 34,584,559 I1484T probably benign Het
Olfr620 T G 7: 103,612,014 E113A probably damaging Het
Paxbp1 A T 16: 91,023,444 M697K probably benign Het
Plxnb1 A G 9: 109,108,924 Y1246C probably damaging Het
Prr5 C T 15: 84,693,804 R96C probably damaging Het
Ptpn7 G T 1: 135,134,502 C62F probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sall2 A C 14: 52,312,724 *1003G probably null Het
Slc5a4b C A 10: 76,103,862 V147F probably damaging Het
Snapc4 A G 2: 26,368,303 W702R probably benign Het
Tbc1d32 A T 10: 56,028,061 C1203* probably null Het
Tmprss11d T A 5: 86,309,425 Y125F probably damaging Het
Tpp1 G A 7: 105,746,956 T512I probably benign Het
Tyw5 G A 1: 57,401,411 A64V probably damaging Het
Other mutations in Gatsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Gatsl2 APN 5 134138272 missense probably benign 0.12
IGL01924:Gatsl2 APN 5 134135602 missense probably benign 0.45
IGL02302:Gatsl2 APN 5 134135643 missense possibly damaging 0.85
R0733:Gatsl2 UTSW 5 134136215 missense possibly damaging 0.87
R1485:Gatsl2 UTSW 5 134137133 missense probably damaging 1.00
R1522:Gatsl2 UTSW 5 134125887 missense probably damaging 0.97
R2130:Gatsl2 UTSW 5 134136153 missense probably damaging 1.00
R2131:Gatsl2 UTSW 5 134136153 missense probably damaging 1.00
R2132:Gatsl2 UTSW 5 134136153 missense probably damaging 1.00
R2133:Gatsl2 UTSW 5 134136153 missense probably damaging 1.00
R4211:Gatsl2 UTSW 5 134125944 critical splice donor site probably null
R6722:Gatsl2 UTSW 5 134135619 missense probably benign 0.38
R6959:Gatsl2 UTSW 5 134135213 missense probably damaging 1.00
X0028:Gatsl2 UTSW 5 134138063 missense possibly damaging 0.92
X0064:Gatsl2 UTSW 5 134135581 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGGTAGGGTGATCTGAGACTC -3'
(R):5'- TTTGTACAAGGTGCTCTGGC -3'

Sequencing Primer
(F):5'- TGAGACTCAGAGACTCGGCTTTC -3'
(R):5'- TGAGACTGTCCTTGCCAACAG -3'
Posted On2018-05-24