Incidental Mutation 'R6424:Arap2'
ID 518259
Institutional Source Beutler Lab
Gene Symbol Arap2
Ensembl Gene ENSMUSG00000037999
Gene Name ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Synonyms Centd1
MMRRC Submission 044387-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6424 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 62759788-62923502 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62840707 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 720 (K720E)
Ref Sequence ENSEMBL: ENSMUSP00000075924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076623]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000076623
AA Change: K720E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075924
Gene: ENSMUSG00000037999
AA Change: K720E

DomainStartEndE-ValueType
SAM 3 70 3.69e-7 SMART
low complexity region 222 233 N/A INTRINSIC
PH 481 574 6.45e-17 SMART
PH 586 679 9.05e-12 SMART
ArfGap 684 805 9.2e-33 SMART
PH 891 1003 1.51e-8 SMART
PH 1013 1112 9.21e-4 SMART
RhoGAP 1124 1300 1.36e-50 SMART
Pfam:RA 1325 1416 2.1e-7 PFAM
PH 1429 1533 2.68e-14 SMART
coiled coil region 1561 1590 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201373
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,460,542 (GRCm39) V4184A probably benign Het
Acvr2b T A 9: 119,231,645 (GRCm39) W12R probably benign Het
Cr1l A C 1: 194,800,123 (GRCm39) F184V probably damaging Het
Haus8 C T 8: 71,704,080 (GRCm39) W359* probably null Het
Insm2 A T 12: 55,646,867 (GRCm39) I204F probably damaging Het
Katnb1 T A 8: 95,820,144 (GRCm39) I97N probably damaging Het
Kif1b T C 4: 149,277,053 (GRCm39) M1337V probably benign Het
Map2 A T 1: 66,453,946 (GRCm39) K945N possibly damaging Het
Meltf T A 16: 31,699,080 (GRCm39) C63* probably null Het
Nbas T C 12: 13,465,734 (GRCm39) probably null Het
Or5p1 G A 7: 107,916,412 (GRCm39) V104I probably benign Het
Raf1 T C 6: 115,596,542 (GRCm39) E594G probably benign Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Scgb2b19 A C 7: 32,978,022 (GRCm39) S92A possibly damaging Het
Serpinb3c T A 1: 107,199,359 (GRCm39) *387Y probably null Het
Shpk A T 11: 73,104,318 (GRCm39) I156F possibly damaging Het
Smarcd1 T C 15: 99,602,248 (GRCm39) F128L probably damaging Het
Tars3 G A 7: 65,305,487 (GRCm39) G237E probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Ttn T C 2: 76,719,848 (GRCm39) probably benign Het
Vmn1r223 T A 13: 23,434,345 (GRCm39) I313N probably damaging Het
Other mutations in Arap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Arap2 APN 5 62,793,305 (GRCm39) missense probably damaging 1.00
IGL00642:Arap2 APN 5 62,890,401 (GRCm39) nonsense probably null
IGL00705:Arap2 APN 5 62,835,366 (GRCm39) missense probably damaging 1.00
IGL00942:Arap2 APN 5 62,855,732 (GRCm39) nonsense probably null
IGL01069:Arap2 APN 5 62,807,199 (GRCm39) missense probably benign
IGL01601:Arap2 APN 5 62,798,685 (GRCm39) missense probably damaging 1.00
IGL01986:Arap2 APN 5 62,779,265 (GRCm39) missense probably damaging 1.00
IGL02032:Arap2 APN 5 62,828,340 (GRCm39) missense probably damaging 0.99
IGL02262:Arap2 APN 5 62,800,184 (GRCm39) missense probably damaging 1.00
IGL02331:Arap2 APN 5 62,807,025 (GRCm39) splice site probably benign
IGL02527:Arap2 APN 5 62,906,650 (GRCm39) missense probably benign
IGL02803:Arap2 APN 5 62,906,452 (GRCm39) missense probably benign
IGL02864:Arap2 APN 5 62,835,308 (GRCm39) missense probably damaging 1.00
IGL03078:Arap2 APN 5 62,890,408 (GRCm39) splice site probably benign
IGL03154:Arap2 APN 5 62,800,268 (GRCm39) missense probably damaging 1.00
IGL03213:Arap2 APN 5 62,906,438 (GRCm39) missense probably benign 0.00
IGL03279:Arap2 APN 5 62,779,253 (GRCm39) missense probably damaging 1.00
IGL03288:Arap2 APN 5 62,761,959 (GRCm39) missense probably benign 0.00
PIT4354001:Arap2 UTSW 5 62,811,392 (GRCm39) missense probably damaging 1.00
R0012:Arap2 UTSW 5 62,840,827 (GRCm39) missense probably damaging 1.00
R0013:Arap2 UTSW 5 62,840,827 (GRCm39) missense probably damaging 1.00
R0013:Arap2 UTSW 5 62,840,827 (GRCm39) missense probably damaging 1.00
R0166:Arap2 UTSW 5 62,833,361 (GRCm39) missense probably damaging 1.00
R0472:Arap2 UTSW 5 62,864,002 (GRCm39) missense probably damaging 1.00
R0506:Arap2 UTSW 5 62,763,474 (GRCm39) missense possibly damaging 0.87
R0551:Arap2 UTSW 5 62,798,666 (GRCm39) splice site probably null
R0607:Arap2 UTSW 5 62,763,474 (GRCm39) missense possibly damaging 0.87
R0617:Arap2 UTSW 5 62,807,250 (GRCm39) splice site probably benign
R0975:Arap2 UTSW 5 62,888,229 (GRCm39) splice site probably benign
R0976:Arap2 UTSW 5 62,807,227 (GRCm39) missense probably damaging 1.00
R1164:Arap2 UTSW 5 62,840,820 (GRCm39) missense probably damaging 1.00
R1268:Arap2 UTSW 5 62,887,964 (GRCm39) missense probably benign 0.00
R1480:Arap2 UTSW 5 62,826,472 (GRCm39) nonsense probably null
R1502:Arap2 UTSW 5 62,761,747 (GRCm39) missense probably benign 0.00
R1543:Arap2 UTSW 5 62,763,498 (GRCm39) nonsense probably null
R1865:Arap2 UTSW 5 62,855,606 (GRCm39) missense probably damaging 0.97
R1962:Arap2 UTSW 5 62,834,007 (GRCm39) missense possibly damaging 0.82
R2040:Arap2 UTSW 5 62,906,259 (GRCm39) missense probably damaging 0.99
R2118:Arap2 UTSW 5 62,864,028 (GRCm39) missense probably damaging 1.00
R2131:Arap2 UTSW 5 62,835,301 (GRCm39) missense probably damaging 1.00
R2201:Arap2 UTSW 5 62,864,028 (GRCm39) missense probably damaging 1.00
R2215:Arap2 UTSW 5 62,834,519 (GRCm39) missense probably damaging 1.00
R3027:Arap2 UTSW 5 62,827,240 (GRCm39) missense probably damaging 1.00
R3053:Arap2 UTSW 5 62,906,200 (GRCm39) missense probably benign 0.35
R3975:Arap2 UTSW 5 62,906,237 (GRCm39) missense possibly damaging 0.87
R4272:Arap2 UTSW 5 62,828,322 (GRCm39) missense possibly damaging 0.63
R4273:Arap2 UTSW 5 62,828,322 (GRCm39) missense possibly damaging 0.63
R4326:Arap2 UTSW 5 62,779,206 (GRCm39) missense possibly damaging 0.50
R4327:Arap2 UTSW 5 62,779,206 (GRCm39) missense possibly damaging 0.50
R4328:Arap2 UTSW 5 62,779,206 (GRCm39) missense possibly damaging 0.50
R4451:Arap2 UTSW 5 62,906,513 (GRCm39) missense probably benign 0.06
R4659:Arap2 UTSW 5 62,811,469 (GRCm39) missense possibly damaging 0.94
R4665:Arap2 UTSW 5 62,827,312 (GRCm39) missense possibly damaging 0.95
R4715:Arap2 UTSW 5 62,906,437 (GRCm39) missense probably benign 0.43
R4808:Arap2 UTSW 5 62,887,984 (GRCm39) missense probably benign 0.23
R4941:Arap2 UTSW 5 62,906,821 (GRCm39) missense probably benign 0.20
R4983:Arap2 UTSW 5 62,833,868 (GRCm39) missense probably damaging 0.98
R5095:Arap2 UTSW 5 62,811,392 (GRCm39) missense probably damaging 1.00
R5156:Arap2 UTSW 5 62,826,524 (GRCm39) nonsense probably null
R5201:Arap2 UTSW 5 62,840,832 (GRCm39) missense probably damaging 1.00
R5346:Arap2 UTSW 5 62,872,089 (GRCm39) missense probably benign 0.39
R5359:Arap2 UTSW 5 62,840,762 (GRCm39) nonsense probably null
R5426:Arap2 UTSW 5 62,800,159 (GRCm39) missense probably benign 0.02
R5503:Arap2 UTSW 5 62,787,529 (GRCm39) missense probably damaging 1.00
R5605:Arap2 UTSW 5 62,772,410 (GRCm39) missense possibly damaging 0.47
R5764:Arap2 UTSW 5 62,800,197 (GRCm39) missense probably damaging 1.00
R5813:Arap2 UTSW 5 62,834,506 (GRCm39) missense probably damaging 1.00
R5846:Arap2 UTSW 5 62,807,116 (GRCm39) missense probably damaging 1.00
R6084:Arap2 UTSW 5 62,828,297 (GRCm39) missense possibly damaging 0.89
R6173:Arap2 UTSW 5 62,906,965 (GRCm39) missense probably damaging 1.00
R6175:Arap2 UTSW 5 62,872,074 (GRCm39) critical splice donor site probably null
R6249:Arap2 UTSW 5 62,803,536 (GRCm39) missense probably damaging 0.99
R6386:Arap2 UTSW 5 62,761,865 (GRCm39) missense possibly damaging 0.89
R6744:Arap2 UTSW 5 62,906,281 (GRCm39) missense probably damaging 1.00
R6766:Arap2 UTSW 5 62,834,443 (GRCm39) critical splice donor site probably null
R6990:Arap2 UTSW 5 62,833,860 (GRCm39) missense probably damaging 0.96
R7067:Arap2 UTSW 5 62,811,387 (GRCm39) critical splice donor site probably null
R7098:Arap2 UTSW 5 62,833,293 (GRCm39) critical splice donor site probably null
R7107:Arap2 UTSW 5 62,763,551 (GRCm39) missense probably damaging 0.98
R7156:Arap2 UTSW 5 62,761,914 (GRCm39) missense probably damaging 1.00
R7174:Arap2 UTSW 5 62,761,621 (GRCm39) missense probably benign
R7187:Arap2 UTSW 5 62,826,396 (GRCm39) missense probably damaging 0.99
R7197:Arap2 UTSW 5 62,798,729 (GRCm39) missense possibly damaging 0.89
R7214:Arap2 UTSW 5 62,906,681 (GRCm39) missense probably benign 0.00
R7317:Arap2 UTSW 5 62,807,067 (GRCm39) missense probably damaging 1.00
R7392:Arap2 UTSW 5 62,855,728 (GRCm39) missense possibly damaging 0.54
R7438:Arap2 UTSW 5 62,906,818 (GRCm39) missense probably damaging 0.99
R7452:Arap2 UTSW 5 62,833,892 (GRCm39) missense probably benign 0.00
R7495:Arap2 UTSW 5 62,833,893 (GRCm39) missense possibly damaging 0.78
R7796:Arap2 UTSW 5 62,888,105 (GRCm39) missense probably damaging 1.00
R7936:Arap2 UTSW 5 62,888,048 (GRCm39) missense probably damaging 0.96
R8116:Arap2 UTSW 5 62,887,954 (GRCm39) missense probably benign 0.00
R8172:Arap2 UTSW 5 62,779,324 (GRCm39) splice site probably null
R8277:Arap2 UTSW 5 62,771,335 (GRCm39) critical splice donor site probably null
R8369:Arap2 UTSW 5 62,761,669 (GRCm39) nonsense probably null
R8398:Arap2 UTSW 5 62,906,252 (GRCm39) missense probably damaging 1.00
R8893:Arap2 UTSW 5 62,888,037 (GRCm39) missense probably damaging 1.00
R8973:Arap2 UTSW 5 62,855,668 (GRCm39) nonsense probably null
R9102:Arap2 UTSW 5 62,906,341 (GRCm39) missense probably benign 0.03
R9121:Arap2 UTSW 5 62,906,326 (GRCm39) missense possibly damaging 0.84
R9174:Arap2 UTSW 5 62,855,606 (GRCm39) missense probably damaging 1.00
R9222:Arap2 UTSW 5 62,828,421 (GRCm39) missense possibly damaging 0.96
R9281:Arap2 UTSW 5 62,906,848 (GRCm39) missense probably damaging 0.97
R9399:Arap2 UTSW 5 62,763,455 (GRCm39) missense possibly damaging 0.62
R9450:Arap2 UTSW 5 62,855,762 (GRCm39) missense probably benign 0.16
R9467:Arap2 UTSW 5 62,887,900 (GRCm39) missense probably benign 0.00
R9567:Arap2 UTSW 5 62,761,841 (GRCm39) missense probably benign 0.01
R9577:Arap2 UTSW 5 62,769,060 (GRCm39) missense probably damaging 1.00
R9626:Arap2 UTSW 5 62,906,878 (GRCm39) missense probably benign 0.00
R9688:Arap2 UTSW 5 62,872,109 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAGTCAACCCAAATGTTATTGC -3'
(R):5'- CTTCACAGCAGATTCGGAGAG -3'

Sequencing Primer
(F):5'- CATTACCCAGGGCACTTTA -3'
(R):5'- CAGCAGATTCGGAGAGAGAGAAAC -3'
Posted On 2018-05-24