Incidental Mutation 'R6424:Tarsl2'
ID518262
Institutional Source Beutler Lab
Gene Symbol Tarsl2
Ensembl Gene ENSMUSG00000030515
Gene Namethreonyl-tRNA synthetase-like 2
SynonymsA530046H20Rik
MMRRC Submission 044387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R6424 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location65644898-65692091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65655739 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 237 (G237E)
Ref Sequence ENSEMBL: ENSMUSP00000032728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032728]
Predicted Effect probably damaging
Transcript: ENSMUST00000032728
AA Change: G237E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032728
Gene: ENSMUSG00000030515
AA Change: G237E

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
coiled coil region 44 68 N/A INTRINSIC
Pfam:TGS 151 210 8.8e-14 PFAM
tRNA_SAD 316 365 1.26e-16 SMART
Pfam:tRNA-synt_2b 464 675 2.2e-35 PFAM
Pfam:HGTP_anticodon 687 778 1.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206323
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,510,542 V4184A probably benign Het
Acvr2b T A 9: 119,402,579 W12R probably benign Het
Arap2 T C 5: 62,683,364 K720E probably damaging Het
Cr1l A C 1: 195,117,815 F184V probably damaging Het
Haus8 C T 8: 71,251,436 W359* probably null Het
Insm2 A T 12: 55,600,082 I204F probably damaging Het
Katnb1 T A 8: 95,093,516 I97N probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map2 A T 1: 66,414,787 K945N possibly damaging Het
Meltf T A 16: 31,880,262 C63* probably null Het
Nbas T C 12: 13,415,733 probably null Het
Olfr491 G A 7: 108,317,205 V104I probably benign Het
Raf1 T C 6: 115,619,581 E594G probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scgb2b19 A C 7: 33,278,597 S92A possibly damaging Het
Serpinb3c T A 1: 107,271,629 *387Y probably null Het
Shpk A T 11: 73,213,492 I156F possibly damaging Het
Smarcd1 T C 15: 99,704,367 F128L probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Ttn T C 2: 76,889,504 probably benign Het
Vmn1r223 T A 13: 23,250,175 I313N probably damaging Het
Other mutations in Tarsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Tarsl2 APN 7 65652259 critical splice acceptor site probably null
IGL00470:Tarsl2 APN 7 65688908 missense probably benign 0.03
IGL00594:Tarsl2 APN 7 65676132 critical splice donor site probably null
IGL01352:Tarsl2 APN 7 65658910 missense possibly damaging 0.80
IGL01519:Tarsl2 APN 7 65663886 missense probably damaging 1.00
IGL01726:Tarsl2 APN 7 65682818 missense possibly damaging 0.46
IGL02370:Tarsl2 APN 7 65661165 missense probably benign 0.17
IGL02729:Tarsl2 APN 7 65682819 missense probably damaging 0.97
IGL03234:Tarsl2 APN 7 65652278 missense probably benign 0.06
gary UTSW 7 65688952 critical splice donor site probably null
smart_money UTSW 7 65678142 missense probably damaging 1.00
R0127:Tarsl2 UTSW 7 65664969 missense probably benign 0.19
R0153:Tarsl2 UTSW 7 65684081 missense probably damaging 1.00
R0605:Tarsl2 UTSW 7 65678071 missense probably damaging 1.00
R1070:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R1450:Tarsl2 UTSW 7 65647496 missense probably benign 0.01
R1467:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R1467:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R2142:Tarsl2 UTSW 7 65658897 missense probably benign
R2143:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R2144:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R2145:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R2208:Tarsl2 UTSW 7 65682848 missense probably damaging 1.00
R3713:Tarsl2 UTSW 7 65688952 critical splice donor site probably null
R3715:Tarsl2 UTSW 7 65688952 critical splice donor site probably null
R3914:Tarsl2 UTSW 7 65683808 missense probably benign 0.05
R3929:Tarsl2 UTSW 7 65684043 intron probably null
R4008:Tarsl2 UTSW 7 65678128 missense probably damaging 1.00
R4064:Tarsl2 UTSW 7 65652270 missense possibly damaging 0.90
R4367:Tarsl2 UTSW 7 65682819 missense probably damaging 0.97
R4652:Tarsl2 UTSW 7 65689969 missense probably damaging 1.00
R4825:Tarsl2 UTSW 7 65647554 missense probably benign 0.38
R4901:Tarsl2 UTSW 7 65691294 missense probably benign 0.05
R4999:Tarsl2 UTSW 7 65658935 missense probably damaging 0.99
R5423:Tarsl2 UTSW 7 65683819 missense probably benign 0.00
R5756:Tarsl2 UTSW 7 65675976 missense probably benign 0.22
R5772:Tarsl2 UTSW 7 65684125 missense probably damaging 1.00
R6160:Tarsl2 UTSW 7 65682779 missense probably benign 0.32
R6230:Tarsl2 UTSW 7 65686436 unclassified probably null
R6615:Tarsl2 UTSW 7 65678142 missense probably damaging 1.00
R6792:Tarsl2 UTSW 7 65662303 missense probably damaging 1.00
R7350:Tarsl2 UTSW 7 65658924 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTTGCAGGGGAGCATGC -3'
(R):5'- CCAGTTTTCACAAATGGCTAACC -3'

Sequencing Primer
(F):5'- CACATAGGTGTTGGGGACTCTCTAC -3'
(R):5'- TGGCTAACCACTTGACAATCAC -3'
Posted On2018-05-24