Mutagenetix > Incidental Mutation

Incidental Mutation 'R6426:Sf3b1'

518315

Institutional Source

Beutler Lab

Gene Symbol

Sf3b1

Ensembl Gene

ENSMUSG00000025982

Gene Name

splicing factor 3b, subunit 1

Synonyms

Prp10, SAP155, SF3b155, 2810001M05Rik, Targ4

MMRRC Submission

044565-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6426 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55024328-55066640 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 55038814 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 823 (M823K)

Ref Sequence

ENSEMBL: ENSMUSP00000027127 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027127]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027127
AA Change: M823K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: M823K

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	65	75	N/A	INTRINSIC
internal_repeat_1	185	276	1.77e-12	PROSPERO
Pfam:SF3b1	329	452	1.2e-51	PFAM
SCOP:d1qbkb_	489	1289	5e-62	SMART
Blast:ARM	593	637	6e-13	BLAST
Blast:ARM	1005	1044	7e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187500

Meta Mutation Damage Score

0.2643

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.5%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abat	C	T	16: 8,420,300 (GRCm39)		probably benign	Het
Adcyap1r1	T	G	6: 55,471,172 (GRCm39)	L365R	probably damaging	Het
Adgre4	A	G	17: 56,109,196 (GRCm39)	N401S	probably benign	Het
Adgrl3	A	T	5: 81,874,717 (GRCm39)	S1073C	probably damaging	Het
Bicral	G	A	17: 47,141,005 (GRCm39)	P26S	probably benign	Het
Cst3	G	T	2: 148,713,917 (GRCm39)	T129K	probably benign	Het
Cyp26a1	T	C	19: 37,687,753 (GRCm39)	M287T	probably benign	Het
Daam2	C	T	17: 49,776,404 (GRCm39)	E828K	probably damaging	Het
Dmxl1	T	C	18: 49,997,645 (GRCm39)	V611A	probably damaging	Het
Fam149a	C	A	8: 45,834,611 (GRCm39)	A63S	probably benign	Het
Fhip2a	T	G	19: 57,371,610 (GRCm39)	L574R	probably damaging	Het
Foxred2	C	G	15: 77,837,508 (GRCm39)	A243P	probably damaging	Het
Gm3604	A	T	13: 62,517,436 (GRCm39)	D307E	probably damaging	Het
Lca5	G	A	9: 83,277,707 (GRCm39)	Q546*	probably null	Het
Mfsd4b1	T	C	10: 39,882,073 (GRCm39)	T71A	possibly damaging	Het
Onecut1	A	G	9: 74,769,631 (GRCm39)	H18R	probably damaging	Het
Or5a1	A	G	19: 12,097,212 (GRCm39)	V288A	probably benign	Het
Paqr7	A	G	4: 134,234,278 (GRCm39)	Y45C	probably damaging	Het
Pcsk5	G	T	19: 17,595,093 (GRCm39)	Q414K	probably damaging	Het
Ppp4r2	T	C	6: 100,829,558 (GRCm39)	Y77H	probably damaging	Het
Prr19	A	G	7: 25,003,262 (GRCm39)	D292G	probably damaging	Het
Pum1	G	A	4: 130,481,283 (GRCm39)	R464H	probably damaging	Het
Rhoq	G	T	17: 87,302,442 (GRCm39)	R126L	probably damaging	Het
Sdhb	A	G	4: 140,701,029 (GRCm39)	K162E	probably benign	Het
Sema3d	G	A	5: 12,613,231 (GRCm39)	G436E	probably damaging	Het
Smc1b	C	T	15: 84,976,232 (GRCm39)	R825Q	probably benign	Het
Syne2	G	T	12: 75,969,857 (GRCm39)	E977D	probably null	Het
Tns2	A	T	15: 102,015,472 (GRCm39)	M125L	possibly damaging	Het
Ttn	T	A	2: 76,542,313 (GRCm39)	K31812*	probably null	Het
Ube4b	G	A	4: 149,510,453 (GRCm39)		probably benign	Het
Vmn2r91	G	A	17: 18,355,865 (GRCm39)		probably null	Het
Zbtb49	G	A	5: 38,360,431 (GRCm39)		probably null	Het
Zswim8	T	A	14: 20,768,594 (GRCm39)	S1035T	probably damaging	Het

Other mutations in Sf3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Sf3b1	APN	1	55,026,645 (GRCm39)	missense	probably damaging	1.00
IGL00815:Sf3b1	APN	1	55,036,090 (GRCm39)	splice site	probably benign
IGL01380:Sf3b1	APN	1	55,027,108 (GRCm39)	missense	probably damaging	1.00
IGL01390:Sf3b1	APN	1	55,026,588 (GRCm39)	missense	probably benign	0.17
IGL02974:Sf3b1	APN	1	55,046,866 (GRCm39)	missense	probably benign	0.00
IGL03159:Sf3b1	APN	1	55,051,372 (GRCm39)	missense	probably benign
Colt	UTSW	1	55,036,315 (GRCm39)	missense	probably benign	0.45
Glock	UTSW	1	55,040,205 (GRCm39)	missense	probably damaging	0.96
Handgun	UTSW	1	55,046,666 (GRCm39)	missense	probably damaging	1.00
Kalashnikov	UTSW	1	55,058,424 (GRCm39)	missense	probably damaging	0.99
Magazine	UTSW	1	55,051,341 (GRCm39)	nonsense	probably null
Revolver	UTSW	1	55,058,548 (GRCm39)	nonsense	probably null
R0053:Sf3b1	UTSW	1	55,039,532 (GRCm39)	nonsense	probably null
R0053:Sf3b1	UTSW	1	55,039,532 (GRCm39)	nonsense	probably null
R0190:Sf3b1	UTSW	1	55,029,465 (GRCm39)	missense	probably damaging	0.99
R0277:Sf3b1	UTSW	1	55,058,416 (GRCm39)	missense	probably damaging	0.99
R0323:Sf3b1	UTSW	1	55,058,416 (GRCm39)	missense	probably damaging	0.99
R0369:Sf3b1	UTSW	1	55,037,267 (GRCm39)	missense	probably benign	0.10
R0396:Sf3b1	UTSW	1	55,058,430 (GRCm39)	missense	probably damaging	1.00
R0718:Sf3b1	UTSW	1	55,058,544 (GRCm39)	missense	probably damaging	0.99
R0991:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1082:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1083:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1084:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1196:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1376:Sf3b1	UTSW	1	55,058,424 (GRCm39)	missense	probably damaging	0.99
R1376:Sf3b1	UTSW	1	55,058,424 (GRCm39)	missense	probably damaging	0.99
R1381:Sf3b1	UTSW	1	55,042,313 (GRCm39)	missense	probably damaging	0.99
R1436:Sf3b1	UTSW	1	55,040,580 (GRCm39)	missense	possibly damaging	0.72
R1559:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1560:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1561:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1567:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1568:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1588:Sf3b1	UTSW	1	55,036,336 (GRCm39)	missense	probably benign	0.05
R1625:Sf3b1	UTSW	1	55,058,536 (GRCm39)	missense	probably damaging	1.00
R1694:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1735:Sf3b1	UTSW	1	55,039,811 (GRCm39)	missense	probably damaging	1.00
R1900:Sf3b1	UTSW	1	55,037,347 (GRCm39)	missense	possibly damaging	0.75
R2186:Sf3b1	UTSW	1	55,046,792 (GRCm39)	missense	probably benign
R2429:Sf3b1	UTSW	1	55,055,960 (GRCm39)	missense	possibly damaging	0.71
R2473:Sf3b1	UTSW	1	55,038,785 (GRCm39)	critical splice donor site	probably null
R3772:Sf3b1	UTSW	1	55,039,150 (GRCm39)	intron	probably benign
R3911:Sf3b1	UTSW	1	55,058,548 (GRCm39)	nonsense	probably null
R3970:Sf3b1	UTSW	1	55,051,341 (GRCm39)	nonsense	probably null
R4706:Sf3b1	UTSW	1	55,029,666 (GRCm39)	missense	probably damaging	1.00
R4707:Sf3b1	UTSW	1	55,029,666 (GRCm39)	missense	probably damaging	1.00
R4964:Sf3b1	UTSW	1	55,038,871 (GRCm39)	missense	probably benign
R5053:Sf3b1	UTSW	1	55,036,336 (GRCm39)	missense	probably benign	0.05
R5358:Sf3b1	UTSW	1	55,042,469 (GRCm39)	missense	probably benign	0.09
R5379:Sf3b1	UTSW	1	55,042,309 (GRCm39)	missense	possibly damaging	0.94
R5628:Sf3b1	UTSW	1	55,037,334 (GRCm39)	missense	probably benign	0.27
R5636:Sf3b1	UTSW	1	55,036,352 (GRCm39)	missense	probably damaging	1.00
R6013:Sf3b1	UTSW	1	55,039,457 (GRCm39)	missense	probably damaging	0.98
R6149:Sf3b1	UTSW	1	55,046,666 (GRCm39)	missense	probably damaging	1.00
R6217:Sf3b1	UTSW	1	55,046,677 (GRCm39)	missense	probably damaging	1.00
R6531:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	probably damaging	0.99
R6945:Sf3b1	UTSW	1	55,036,315 (GRCm39)	missense	probably benign	0.45
R7001:Sf3b1	UTSW	1	55,053,640 (GRCm39)	critical splice donor site	probably null
R7001:Sf3b1	UTSW	1	55,040,205 (GRCm39)	missense	probably damaging	0.96
R7302:Sf3b1	UTSW	1	55,055,949 (GRCm39)	missense	probably benign	0.00
R7644:Sf3b1	UTSW	1	55,036,302 (GRCm39)	nonsense	probably null
R7664:Sf3b1	UTSW	1	55,026,626 (GRCm39)	missense	probably damaging	1.00
R7735:Sf3b1	UTSW	1	55,042,508 (GRCm39)	missense	probably benign	0.29
R7809:Sf3b1	UTSW	1	55,034,614 (GRCm39)	missense	possibly damaging	0.60
R8516:Sf3b1	UTSW	1	55,051,262 (GRCm39)	missense	probably null	0.01
R8871:Sf3b1	UTSW	1	55,029,508 (GRCm39)	missense	probably damaging	1.00
R8947:Sf3b1	UTSW	1	55,039,444 (GRCm39)	missense	probably damaging	1.00
R9216:Sf3b1	UTSW	1	55,051,376 (GRCm39)	missense	probably benign	0.00
Z1177:Sf3b1	UTSW	1	55,042,561 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCATCTCTTGTCACAGTAAAGTAC -3'
(R):5'- CGAGAATTTCAGTCTCCTGATGAAG -3'

Sequencing Primer
(F):5'- TCTTGTCACAGTAAAGTACATACAAG -3'
(R):5'- GGTATTGGTACCTACTCATAACTGTG -3'

Posted On

2018-05-24