Incidental Mutation 'R6427:Polr1b'
ID518351
Institutional Source Beutler Lab
Gene Symbol Polr1b
Ensembl Gene ENSMUSG00000027395
Gene Namepolymerase (RNA) I polypeptide B
Synonyms128kDa, RPA116, RPA2, D630020H17Rik, Rpo1-2
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_009086.2; MGI:108014

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6427 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location129100995-129126594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 129123261 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 756 (A756S)
Ref Sequence ENSEMBL: ENSMUSP00000099494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028874] [ENSMUST00000103205]
Predicted Effect probably benign
Transcript: ENSMUST00000028874
SMART Domains Protein: ENSMUSP00000028874
Gene: ENSMUSG00000027395

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 437 4.6e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 8.9e-14 PFAM
Pfam:RNA_pol_Rpb2_3 455 521 1.4e-28 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 3.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103205
AA Change: A756S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099494
Gene: ENSMUSG00000027395
AA Change: A756S

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 423 1.7e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 3.2e-11 PFAM
Pfam:RNA_pol_Rpb2_3 455 520 2.1e-29 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 4.1e-23 PFAM
Pfam:RNA_pol_Rpb2_6 670 1031 9.7e-118 PFAM
Pfam:RNA_pol_Rpb2_7 1033 1135 1.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147727
Meta Mutation Damage Score 0.3 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype Strain: 3774130
Lethality: E2-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic RNA polymerase I (pol I) is responsible for the transcription of ribosomal RNA (rRNA) genes and production of rRNA, the primary component of ribosomes. Pol I is a multisubunit enzyme composed of 6 to 14 polypeptides, depending on the species. Most of the mass of the pol I complex derives from the 2 largest subunits, Rpa1 and Rpa2 in yeast. POLR1B is homologous to Rpa2 (Seither and Grummt, 1996 [PubMed 8921381]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality prior to implantation. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Ankmy2 A G 12: 36,187,711 S270G possibly damaging Het
Anxa2 T A 9: 69,476,149 probably null Het
Arid1a G T 4: 133,681,524 P1891T unknown Het
Atn1 G T 6: 124,746,176 probably benign Het
Atp8b3 A T 10: 80,520,323 probably null Het
Cab39l A C 14: 59,506,270 K94N possibly damaging Het
Cacna2d2 G T 9: 107,515,442 M528I possibly damaging Het
Ccnc T A 4: 21,747,578 probably null Het
Clasp2 C T 9: 113,892,444 T774I probably damaging Het
Cngb1 C T 8: 95,297,759 probably benign Het
Cpt1a T A 19: 3,362,156 F209L probably damaging Het
Cyp2j7 C A 4: 96,227,667 D181Y probably damaging Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Ddr1 C A 17: 35,687,222 R477L probably benign Het
Ech1 A G 7: 28,825,885 T22A probably benign Het
Fbln5 T C 12: 101,761,822 D294G possibly damaging Het
Fkbp15 T C 4: 62,323,202 I569V probably benign Het
Hmcn1 G T 1: 150,697,476 R2141S possibly damaging Het
Kat6b T C 14: 21,517,412 S180P probably benign Het
Lepr G A 4: 101,774,257 E655K possibly damaging Het
Mro T A 18: 73,872,033 L69Q probably damaging Het
Nipbl A T 15: 8,351,565 L581H probably benign Het
Nkiras2 C T 11: 100,625,035 R63W probably damaging Het
Nlrp4e T A 7: 23,320,633 S182T possibly damaging Het
Olfr548-ps1 A T 7: 102,542,688 I251F probably benign Het
Otud4 T C 8: 79,668,497 S553P probably benign Het
Pcdha4 T C 18: 36,953,733 I323T probably benign Het
Prex2 A T 1: 11,182,031 Y1100F probably damaging Het
Rnf219 T C 14: 104,480,226 K237R possibly damaging Het
Serpinb6a A T 13: 33,918,259 S328T probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp5 T C 10: 9,899,254 T52A probably damaging Het
Taf3 A T 2: 9,951,353 F515I probably damaging Het
Unc13b A G 4: 43,176,966 probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vps51 T C 19: 6,070,917 Y322C possibly damaging Het
Wdr66 T C 5: 123,326,533 L1268P probably damaging Het
Zfp735 G A 11: 73,690,314 C59Y possibly damaging Het
Zfp759 A G 13: 67,139,098 probably null Het
Other mutations in Polr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Polr1b APN 2 129125909 missense probably damaging 1.00
IGL00559:Polr1b APN 2 129113731 missense probably damaging 1.00
IGL00659:Polr1b APN 2 129118100 critical splice donor site probably null
IGL00672:Polr1b APN 2 129125472 missense probably damaging 1.00
IGL01066:Polr1b APN 2 129119152 missense probably damaging 1.00
IGL01536:Polr1b APN 2 129125555 missense probably benign 0.00
IGL01596:Polr1b APN 2 129110126 missense probably benign 0.38
IGL02156:Polr1b APN 2 129123879 missense probably benign 0.40
IGL02398:Polr1b APN 2 129102966 missense probably benign 0.03
IGL02797:Polr1b APN 2 129102979 missense probably damaging 0.99
IGL02965:Polr1b APN 2 129125523 missense probably benign 0.41
IGL03009:Polr1b APN 2 129126068 missense probably damaging 1.00
IGL03092:Polr1b APN 2 129123129 missense probably damaging 1.00
IGL03129:Polr1b APN 2 129115707 missense probably benign 0.00
IGL03138:Polr1b UTSW 2 129102988 missense probably benign 0.04
PIT4362001:Polr1b UTSW 2 129109292 missense possibly damaging 0.84
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0989:Polr1b UTSW 2 129126077 missense probably damaging 0.97
R1508:Polr1b UTSW 2 129113734 missense probably benign 0.24
R1539:Polr1b UTSW 2 129118099 critical splice donor site probably null
R1700:Polr1b UTSW 2 129123121 missense probably damaging 0.99
R1843:Polr1b UTSW 2 129102966 missense probably benign 0.03
R1920:Polr1b UTSW 2 129101111 missense probably benign 0.00
R2414:Polr1b UTSW 2 129103134 splice site probably benign
R3020:Polr1b UTSW 2 129115681 missense probably benign 0.01
R3837:Polr1b UTSW 2 129119107 missense possibly damaging 0.78
R4466:Polr1b UTSW 2 129123882 missense probably benign 0.03
R4773:Polr1b UTSW 2 129105328 missense probably benign 0.29
R4789:Polr1b UTSW 2 129109337 missense probably benign 0.00
R5027:Polr1b UTSW 2 129123883 missense possibly damaging 0.94
R5579:Polr1b UTSW 2 129110108 missense probably damaging 1.00
R5705:Polr1b UTSW 2 129105351 nonsense probably null
R6303:Polr1b UTSW 2 129115762 missense probably damaging 1.00
R6313:Polr1b UTSW 2 129125446 missense probably damaging 1.00
R6677:Polr1b UTSW 2 129120211 intron probably benign
R7033:Polr1b UTSW 2 129115642 missense possibly damaging 0.82
R7163:Polr1b UTSW 2 129126011 missense probably benign 0.44
R7184:Polr1b UTSW 2 129123922 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAGCAGACCATGGGCTTTC -3'
(R):5'- CATAGTGTGTCCACGGATATGG -3'

Sequencing Primer
(F):5'- AGACCATGGGCTTTCCGCTG -3'
(R):5'- TCCACGGATATGGAAGATATACAC -3'
Posted On2018-05-24