Mutagenetix > Incidental Mutation

Incidental Mutation 'R6429:C2cd3'

518429

Institutional Source

Beutler Lab

Gene Symbol

C2cd3

Ensembl Gene

ENSMUSG00000047248

Gene Name

C2 calcium-dependent domain containing 3

Synonyms

MMRRC Submission

044567-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6429 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

100021440-100119359 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100081298 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 127 (D127G)

Ref Sequence

ENSEMBL: ENSMUSP00000113728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]

AlphaFold

Q52KB6

Predicted Effect

probably damaging
Transcript: ENSMUST00000051777
AA Change: D1358G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: D1358G

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
low complexity region	2180	2197	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098259
AA Change: D1358G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: D1358G

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119647
AA Change: D980G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: D980G

Domain	Start	End	E-Value	Type
C2	61	199	2.36e1	SMART
C2	327	436	3.73e0	SMART
C2	526	666	1.47e1	SMART
C2	719	858	1.63e1	SMART
C2	1154	1261	1.43e-2	SMART
low complexity region	1429	1443	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120196
AA Change: D127G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248
AA Change: D127G

Domain	Start	End	E-Value	Type
low complexity region	297	308	N/A	INTRINSIC
C2	415	553	1.5e-1	SMART
C2	681	790	2.4e-2	SMART
C2	880	1020	9.5e-2	SMART
C2	1073	1212	1.1e-1	SMART
C2	1508	1615	9e-5	SMART
low complexity region	1783	1797	N/A	INTRINSIC
low complexity region	1928	1940	N/A	INTRINSIC
low complexity region	2001	2016	N/A	INTRINSIC
low complexity region	2071	2087	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185051

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	G	A	5: 114,366,652 (GRCm39)	E1565K	probably damaging	Het
Amy1	T	C	3: 113,363,158 (GRCm39)	N63S	probably damaging	Het
Arhgef15	G	T	11: 68,838,622 (GRCm39)	N591K	probably damaging	Het
AW551984	A	G	9: 39,511,910 (GRCm39)	S34P	probably damaging	Het
Ccdc87	T	A	19: 4,891,263 (GRCm39)	V585E	probably benign	Het
Cemip2	T	C	19: 21,779,272 (GRCm39)	C361R	probably benign	Het
Cul2	T	C	18: 3,421,345 (GRCm39)	I223T	probably damaging	Het
Dgkq	C	T	5: 108,801,574 (GRCm39)	V495M	probably damaging	Het
Dpp10	A	G	1: 123,295,330 (GRCm39)	I570T	possibly damaging	Het
Dstyk	C	T	1: 132,377,542 (GRCm39)	Q383*	probably null	Het
Emilin2	C	A	17: 71,617,951 (GRCm39)		probably benign	Het
Fnip1	A	G	11: 54,406,393 (GRCm39)	I1163M	probably damaging	Het
Fryl	C	T	5: 73,248,094 (GRCm39)	E1008K	possibly damaging	Het
Gm35315	A	T	5: 110,226,525 (GRCm39)	Y305N	possibly damaging	Het
Grhl3	T	A	4: 135,284,507 (GRCm39)	D195V	probably damaging	Het
Ift56	T	A	6: 38,375,248 (GRCm39)	S250T	possibly damaging	Het
Il33	T	C	19: 29,929,400 (GRCm39)	F41S	probably benign	Het
Il4	A	G	11: 53,504,736 (GRCm39)	S15P	possibly damaging	Het
Inf2	C	T	12: 112,570,690 (GRCm39)	P410S	probably benign	Het
Kalrn	T	A	16: 34,152,534 (GRCm39)	D349V	possibly damaging	Het
Krt4	A	G	15: 101,831,229 (GRCm39)	M224T	probably benign	Het
Lrp2	C	T	2: 69,291,631 (GRCm39)	S3516N	probably damaging	Het
Macf1	A	T	4: 123,295,387 (GRCm39)		probably null	Het
Msr1	G	A	8: 40,068,858 (GRCm39)	P213S	probably damaging	Het
Nptx1	G	T	11: 119,435,547 (GRCm39)	C256*	probably null	Het
Nr1d1	T	C	11: 98,662,840 (GRCm39)	Y51C	probably damaging	Het
Or4c11c	G	A	2: 88,661,869 (GRCm39)	R136Q	probably benign	Het
Panx3	T	C	9: 37,572,461 (GRCm39)	D363G	probably damaging	Het
Pira13	A	T	7: 3,825,345 (GRCm39)	H432Q	possibly damaging	Het
Prkag1	A	G	15: 98,712,404 (GRCm39)	F143L	probably damaging	Het
Ptger4	T	C	15: 5,272,478 (GRCm39)	K72R	possibly damaging	Het
Pvrig-ps	A	G	5: 138,340,312 (GRCm39)	T28A	probably benign	Het
Rhod	C	T	19: 4,476,133 (GRCm39)	C206Y	probably benign	Het
Rngtt	C	A	4: 33,320,606 (GRCm39)	S51*	probably null	Het
Rreb1	T	G	13: 38,116,105 (GRCm39)	S1155A	probably benign	Het
Scn9a	A	C	2: 66,357,307 (GRCm39)	I998S	possibly damaging	Het
Sfmbt1	T	A	14: 30,495,868 (GRCm39)	F50L	probably damaging	Het
Six4	A	T	12: 73,150,247 (GRCm39)	V766D	probably damaging	Het
Smpd1	T	C	7: 105,206,135 (GRCm39)	I421T	probably damaging	Het
Son	T	A	16: 91,455,054 (GRCm39)	M1267K	probably benign	Het
Styk1	T	A	6: 131,287,027 (GRCm39)	D156V	possibly damaging	Het
Supt3	A	G	17: 45,430,030 (GRCm39)	E361G	probably benign	Het
Tbx3	T	A	5: 119,812,256 (GRCm39)	Y185*	probably null	Het
Trpm1	A	T	7: 63,918,252 (GRCm39)	T531S	probably benign	Het
Tspan32	T	A	7: 142,572,479 (GRCm39)	W172R	possibly damaging	Het
Urb1	A	T	16: 90,559,318 (GRCm39)		probably null	Het
Vmn2r70	T	A	7: 85,208,276 (GRCm39)	I734F	probably damaging	Het
Vwa7	A	G	17: 35,243,175 (GRCm39)	T618A	probably benign	Het
Wac	T	A	18: 7,920,163 (GRCm39)	V339E	probably damaging	Het
Wrn	G	A	8: 33,833,024 (GRCm39)	T156M	probably damaging	Het
Zeb1	T	A	18: 5,770,498 (GRCm39)	C884S	probably damaging	Het
Zfp747l1	T	C	7: 126,984,214 (GRCm39)		probably benign	Het
Zmpste24	A	G	4: 120,952,867 (GRCm39)	V10A	probably damaging	Het

Other mutations in C2cd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:C2cd3	APN	7	100,040,335 (GRCm39)	missense	probably benign	0.14
IGL01420:C2cd3	APN	7	100,104,065 (GRCm39)	missense	probably benign	0.35
IGL01775:C2cd3	APN	7	100,092,638 (GRCm39)	missense	probably damaging	1.00
IGL01832:C2cd3	APN	7	100,076,421 (GRCm39)	missense	possibly damaging	0.94
IGL01883:C2cd3	APN	7	100,023,693 (GRCm39)	missense	possibly damaging	0.80
IGL02664:C2cd3	APN	7	100,068,922 (GRCm39)	missense	possibly damaging	0.67
IGL02697:C2cd3	APN	7	100,076,376 (GRCm39)	unclassified	probably benign
IGL02852:C2cd3	APN	7	100,079,396 (GRCm39)	missense	probably damaging	1.00
IGL03158:C2cd3	APN	7	100,023,683 (GRCm39)	missense	probably damaging	1.00
R0012:C2cd3	UTSW	7	100,067,729 (GRCm39)	missense	possibly damaging	0.52
R0012:C2cd3	UTSW	7	100,067,729 (GRCm39)	missense	possibly damaging	0.52
R0013:C2cd3	UTSW	7	100,065,269 (GRCm39)	missense	probably damaging	1.00
R0013:C2cd3	UTSW	7	100,065,269 (GRCm39)	missense	probably damaging	1.00
R0032:C2cd3	UTSW	7	100,093,652 (GRCm39)	unclassified	probably benign
R0032:C2cd3	UTSW	7	100,093,652 (GRCm39)	unclassified	probably benign
R0124:C2cd3	UTSW	7	100,118,725 (GRCm39)	missense	probably benign
R0387:C2cd3	UTSW	7	100,071,714 (GRCm39)	splice site	probably benign
R0522:C2cd3	UTSW	7	100,044,429 (GRCm39)	missense	probably benign	0.14
R1124:C2cd3	UTSW	7	100,071,888 (GRCm39)	missense	probably benign	0.00
R1484:C2cd3	UTSW	7	100,089,397 (GRCm39)	missense	probably damaging	1.00
R1533:C2cd3	UTSW	7	100,055,284 (GRCm39)	missense	possibly damaging	0.54
R1631:C2cd3	UTSW	7	100,021,704 (GRCm39)	critical splice donor site	probably null
R1875:C2cd3	UTSW	7	100,056,232 (GRCm39)	missense	possibly damaging	0.89
R2059:C2cd3	UTSW	7	100,104,700 (GRCm39)	unclassified	probably benign
R2060:C2cd3	UTSW	7	100,104,155 (GRCm39)	missense	probably damaging	1.00
R2348:C2cd3	UTSW	7	100,062,573 (GRCm39)	missense	probably damaging	1.00
R3103:C2cd3	UTSW	7	100,044,459 (GRCm39)	missense	possibly damaging	0.47
R3405:C2cd3	UTSW	7	100,039,373 (GRCm39)	missense	probably benign	0.01
R3687:C2cd3	UTSW	7	100,085,040 (GRCm39)	missense	probably benign	0.28
R3775:C2cd3	UTSW	7	100,081,205 (GRCm39)	missense	probably damaging	1.00
R3854:C2cd3	UTSW	7	100,103,808 (GRCm39)	critical splice acceptor site	probably null
R4359:C2cd3	UTSW	7	100,090,296 (GRCm39)	missense	probably damaging	1.00
R4403:C2cd3	UTSW	7	100,081,306 (GRCm39)	missense	probably damaging	1.00
R4446:C2cd3	UTSW	7	100,023,684 (GRCm39)	missense	probably damaging	1.00
R4646:C2cd3	UTSW	7	100,021,657 (GRCm39)	unclassified	probably benign
R4705:C2cd3	UTSW	7	100,044,395 (GRCm39)	missense	possibly damaging	0.77
R4770:C2cd3	UTSW	7	100,092,642 (GRCm39)	missense	probably damaging	1.00
R4777:C2cd3	UTSW	7	100,065,539 (GRCm39)	missense	possibly damaging	0.46
R4816:C2cd3	UTSW	7	100,040,226 (GRCm39)	missense	probably benign	0.01
R4842:C2cd3	UTSW	7	100,065,397 (GRCm39)	missense	probably benign	0.00
R4858:C2cd3	UTSW	7	100,104,160 (GRCm39)	missense	probably damaging	1.00
R4871:C2cd3	UTSW	7	100,062,581 (GRCm39)	missense	possibly damaging	0.79
R4898:C2cd3	UTSW	7	100,055,166 (GRCm39)	missense	probably damaging	1.00
R5026:C2cd3	UTSW	7	100,109,049 (GRCm39)	missense	possibly damaging	0.52
R5112:C2cd3	UTSW	7	100,092,692 (GRCm39)	missense	possibly damaging	0.91
R5242:C2cd3	UTSW	7	100,039,373 (GRCm39)	missense	probably benign	0.01
R5538:C2cd3	UTSW	7	100,104,700 (GRCm39)	critical splice donor site	probably null
R5861:C2cd3	UTSW	7	100,093,682 (GRCm39)	unclassified	probably benign
R6110:C2cd3	UTSW	7	100,090,283 (GRCm39)	missense	probably damaging	1.00
R6326:C2cd3	UTSW	7	100,065,635 (GRCm39)	missense	probably benign	0.02
R6610:C2cd3	UTSW	7	100,104,505 (GRCm39)	missense	probably benign
R6613:C2cd3	UTSW	7	100,044,448 (GRCm39)	missense	possibly damaging	0.87
R6631:C2cd3	UTSW	7	100,067,747 (GRCm39)	missense	probably damaging	1.00
R6787:C2cd3	UTSW	7	100,104,553 (GRCm39)	missense	probably benign
R6837:C2cd3	UTSW	7	100,097,953 (GRCm39)	missense	probably damaging	1.00
R6849:C2cd3	UTSW	7	100,056,134 (GRCm39)	missense	probably damaging	1.00
R6860:C2cd3	UTSW	7	100,039,448 (GRCm39)	missense	probably benign	0.28
R6929:C2cd3	UTSW	7	100,100,826 (GRCm39)	missense	probably damaging	1.00
R7026:C2cd3	UTSW	7	100,081,299 (GRCm39)	missense	probably damaging	1.00
R7088:C2cd3	UTSW	7	100,065,388 (GRCm39)	missense
R7174:C2cd3	UTSW	7	100,081,405 (GRCm39)	missense
R7241:C2cd3	UTSW	7	100,056,257 (GRCm39)	missense
R7335:C2cd3	UTSW	7	100,071,810 (GRCm39)	missense
R7357:C2cd3	UTSW	7	100,079,310 (GRCm39)	missense
R7493:C2cd3	UTSW	7	100,076,433 (GRCm39)	missense
R7567:C2cd3	UTSW	7	100,080,022 (GRCm39)	missense
R7573:C2cd3	UTSW	7	100,068,914 (GRCm39)	missense
R7869:C2cd3	UTSW	7	100,118,698 (GRCm39)	missense	probably damaging	0.99
R7999:C2cd3	UTSW	7	100,109,096 (GRCm39)	critical splice donor site	probably null
R8134:C2cd3	UTSW	7	100,067,711 (GRCm39)	missense
R8369:C2cd3	UTSW	7	100,044,465 (GRCm39)	missense	probably benign	0.03
R8372:C2cd3	UTSW	7	100,104,487 (GRCm39)	nonsense	probably null
R8753:C2cd3	UTSW	7	100,049,024 (GRCm39)	critical splice donor site	probably null
R8893:C2cd3	UTSW	7	100,104,004 (GRCm39)	missense	probably benign
R8905:C2cd3	UTSW	7	100,074,132 (GRCm39)	critical splice donor site	probably null
R8945:C2cd3	UTSW	7	100,040,286 (GRCm39)	missense	possibly damaging	0.88
R8970:C2cd3	UTSW	7	100,068,971 (GRCm39)	missense
R9000:C2cd3	UTSW	7	100,065,281 (GRCm39)	missense
R9064:C2cd3	UTSW	7	100,059,608 (GRCm39)	missense
R9072:C2cd3	UTSW	7	100,040,291 (GRCm39)	missense	probably benign	0.07
R9126:C2cd3	UTSW	7	100,081,430 (GRCm39)	missense
R9160:C2cd3	UTSW	7	100,075,236 (GRCm39)	missense
R9234:C2cd3	UTSW	7	100,049,012 (GRCm39)	missense
R9258:C2cd3	UTSW	7	100,098,026 (GRCm39)	missense
R9295:C2cd3	UTSW	7	100,081,734 (GRCm39)	missense
R9411:C2cd3	UTSW	7	100,065,704 (GRCm39)	missense
R9420:C2cd3	UTSW	7	100,065,262 (GRCm39)	missense
R9589:C2cd3	UTSW	7	100,081,756 (GRCm39)	missense
R9628:C2cd3	UTSW	7	100,097,961 (GRCm39)	missense
R9629:C2cd3	UTSW	7	100,029,249 (GRCm39)	missense	probably damaging	1.00
R9681:C2cd3	UTSW	7	100,023,662 (GRCm39)	missense	probably benign	0.32
R9775:C2cd3	UTSW	7	100,076,458 (GRCm39)	missense
X0002:C2cd3	UTSW	7	100,089,442 (GRCm39)	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- TCTATTCAGCACTGGGCCAG -3'
(R):5'- AAAGGCTTCTTGATTGTACAGC -3'

Sequencing Primer
(F):5'- ACTGGGCCAGGGTAGTG -3'
(R):5'- GTAGCGAAGGTAGCAATATGTATTC -3'

Posted On

2018-05-24