Incidental Mutation 'R6430:Smc6'
ID518496
Institutional Source Beutler Lab
Gene Symbol Smc6
Ensembl Gene ENSMUSG00000020608
Gene Namestructural maintenance of chromosomes 6
Synonyms2810489L22Rik, 3830418C19Rik, Smc6l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6430 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location11265886-11319785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11309234 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 953 (N953S)
Ref Sequence ENSEMBL: ENSMUSP00000020931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020931] [ENSMUST00000218022]
Predicted Effect probably benign
Transcript: ENSMUST00000020931
AA Change: N953S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020931
Gene: ENSMUSG00000020608
AA Change: N953S

DomainStartEndE-ValueType
Pfam:SMC_N 53 1077 4.7e-17 PFAM
Pfam:AAA_15 54 438 3.1e-9 PFAM
Pfam:AAA_23 56 398 5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218319
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit poor embryonic development and embryonic lethality by E105. Mice homozygous for a hypomorphic allele exhibit decreased body weight and weight, decreased litter size and partial lethality. Mice homozygous for a point mutation exhibit a milder phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI661453 C A 17: 47,466,797 probably benign Het
Als2cr12 T A 1: 58,678,289 K154N probably damaging Het
Ank1 T A 8: 23,132,109 L1513Q probably damaging Het
Ap2a1 C A 7: 44,903,829 V676L probably benign Het
Arid2 T C 15: 96,363,694 V477A probably benign Het
Auh C A 13: 52,929,410 G17C probably benign Het
B3gnt7 T C 1: 86,306,117 F362L possibly damaging Het
Cd207 C T 6: 83,675,887 R87H probably benign Het
Cdyl A G 13: 35,871,606 K503R possibly damaging Het
Cep350 A G 1: 155,894,673 S1824P probably damaging Het
Cmas T A 6: 142,767,924 M225K probably benign Het
Dhx29 T C 13: 112,944,619 S396P possibly damaging Het
Epg5 T C 18: 77,975,885 S958P probably damaging Het
Espnl T C 1: 91,322,248 L39P possibly damaging Het
Fuk A G 8: 110,884,116 V915A probably benign Het
Gatb A G 3: 85,637,038 N438D probably benign Het
Hspg2 T C 4: 137,539,396 C1932R probably damaging Het
Jmjd1c C T 10: 67,224,160 T662I possibly damaging Het
Kcng4 A G 8: 119,633,050 S196P probably damaging Het
Kcnh7 T G 2: 62,850,532 H237P probably benign Het
Klhl38 T C 15: 58,322,311 T341A probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Man2c1 T C 9: 57,131,233 V59A possibly damaging Het
Nr2c1 A T 10: 94,195,341 H588L possibly damaging Het
Olfr137 T C 17: 38,305,358 I34M probably benign Het
Olfr305 A T 7: 86,363,973 Y121* probably null Het
Osbpl6 A G 2: 76,579,276 E494G probably damaging Het
Per1 T C 11: 69,104,296 L638S probably damaging Het
Plekhn1 T C 4: 156,221,804 E603G probably benign Het
Prss12 A T 3: 123,479,594 S280C probably damaging Het
Pudp A G 18: 50,568,236 I142T probably benign Het
Rabl6 A T 2: 25,584,837 N620K probably damaging Het
Rttn T A 18: 89,021,685 C837S probably null Het
Slc16a7 A G 10: 125,231,018 S251P probably damaging Het
Slc7a10 A G 7: 35,197,658 I195V probably benign Het
Slc9a4 A T 1: 40,600,854 R269* probably null Het
Slco6c1 T A 1: 97,075,974 Q466L probably benign Het
Tex15 T C 8: 33,571,301 V527A probably benign Het
Tln2 T C 9: 67,272,665 Y808C probably damaging Het
Tmem145 T C 7: 25,309,038 L289P possibly damaging Het
Trim3 A G 7: 105,618,005 V389A probably benign Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Vps11 C A 9: 44,361,550 A28S probably benign Het
Zbtb41 T A 1: 139,447,207 S802T probably benign Het
Zmynd10 A T 9: 107,548,712 K82* probably null Het
Other mutations in Smc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smc6 APN 12 11299263 missense possibly damaging 0.48
IGL00562:Smc6 APN 12 11301531 missense probably benign 0.02
IGL00563:Smc6 APN 12 11301531 missense probably benign 0.02
IGL01420:Smc6 APN 12 11291658 missense probably benign 0.27
IGL02299:Smc6 APN 12 11290751 missense probably benign 0.00
R0207:Smc6 UTSW 12 11283178 unclassified probably benign
R0365:Smc6 UTSW 12 11283174 critical splice donor site probably null
R0669:Smc6 UTSW 12 11289164 missense probably benign 0.41
R0732:Smc6 UTSW 12 11290817 missense probably damaging 0.96
R1398:Smc6 UTSW 12 11271879 splice site probably benign
R1509:Smc6 UTSW 12 11279733 missense possibly damaging 0.55
R1739:Smc6 UTSW 12 11317853 missense probably benign 0.05
R1775:Smc6 UTSW 12 11309269 missense probably benign 0.00
R1815:Smc6 UTSW 12 11294601 critical splice donor site probably null
R1937:Smc6 UTSW 12 11299398 missense probably benign 0.06
R2090:Smc6 UTSW 12 11289986 missense probably benign 0.08
R2885:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2886:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2991:Smc6 UTSW 12 11289981 missense probably damaging 0.96
R3825:Smc6 UTSW 12 11301516 splice site probably benign
R3967:Smc6 UTSW 12 11298326 missense probably benign 0.13
R3975:Smc6 UTSW 12 11274074 missense probably damaging 0.99
R4660:Smc6 UTSW 12 11274007 missense probably damaging 1.00
R5372:Smc6 UTSW 12 11282430 missense probably damaging 1.00
R5412:Smc6 UTSW 12 11285399 missense possibly damaging 0.88
R5523:Smc6 UTSW 12 11291539 missense probably benign 0.31
R5643:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5644:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5782:Smc6 UTSW 12 11290834 missense probably damaging 1.00
R6027:Smc6 UTSW 12 11306178 missense probably benign 0.04
R6083:Smc6 UTSW 12 11276353 missense possibly damaging 0.95
R6344:Smc6 UTSW 12 11297106 intron probably benign
R6374:Smc6 UTSW 12 11305873 intron probably null
R6539:Smc6 UTSW 12 11297010 unclassified probably null
R6767:Smc6 UTSW 12 11271820 missense possibly damaging 0.93
R7042:Smc6 UTSW 12 11309300 missense probably damaging 1.00
R7128:Smc6 UTSW 12 11301631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACTTGGGGAAACTGGC -3'
(R):5'- CTAGCAAAGGCCATCTTTAACTTAG -3'

Sequencing Primer
(F):5'- GAGATGCATATGTACTTTCATGTCTC -3'
(R):5'- GGTCAATCAATGTTTCACG -3'
Posted On2018-05-24