Incidental Mutation 'R6431:Pum1'
ID518525
Institutional Source Beutler Lab
Gene Symbol Pum1
Ensembl Gene ENSMUSG00000028580
Gene Namepumilio RNA-binding family member 1
SynonymsPumm
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R6431 (G1)
Quality Score220.009
Status Validated
Chromosome4
Chromosomal Location130663321-130781564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130774505 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 868 (S868R)
Ref Sequence ENSEMBL: ENSMUSP00000101612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030315] [ENSMUST00000097862] [ENSMUST00000097864] [ENSMUST00000105991] [ENSMUST00000105992]
Predicted Effect probably damaging
Transcript: ENSMUST00000030315
AA Change: S1113R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030315
Gene: ENSMUSG00000028580
AA Change: S1113R

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 443 458 N/A INTRINSIC
low complexity region 476 503 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 584 615 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 643 666 N/A INTRINSIC
low complexity region 672 696 N/A INTRINSIC
low complexity region 731 741 N/A INTRINSIC
low complexity region 763 783 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Pumilio 849 884 1.75e-6 SMART
Pumilio 885 920 4.03e-6 SMART
Pumilio 921 955 5.24e-5 SMART
Pumilio 959 994 3.37e-8 SMART
Pumilio 995 1030 6.29e-8 SMART
Pumilio 1031 1066 1.04e-8 SMART
Pumilio 1067 1102 6.2e-7 SMART
Pumilio 1110 1145 8.77e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083856
Predicted Effect probably damaging
Transcript: ENSMUST00000097862
AA Change: S1112R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095474
Gene: ENSMUSG00000028580
AA Change: S1112R

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 954 5.24e-5 SMART
Pumilio 958 993 3.37e-8 SMART
Pumilio 994 1029 6.29e-8 SMART
Pumilio 1030 1065 1.04e-8 SMART
Pumilio 1066 1101 6.2e-7 SMART
Pumilio 1109 1144 8.77e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097864
AA Change: S1110R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095476
Gene: ENSMUSG00000028580
AA Change: S1110R

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 955 5.48e-8 SMART
Pumilio 956 991 3.37e-8 SMART
Pumilio 992 1027 6.29e-8 SMART
Pumilio 1028 1063 1.04e-8 SMART
Pumilio 1064 1099 6.2e-7 SMART
Pumilio 1107 1142 8.77e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105991
AA Change: S868R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101612
Gene: ENSMUSG00000028580
AA Change: S868R

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 233 260 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 341 372 N/A INTRINSIC
low complexity region 384 394 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
low complexity region 429 453 N/A INTRINSIC
low complexity region 488 498 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 555 573 N/A INTRINSIC
Pumilio 606 641 1.75e-6 SMART
Pumilio 642 677 4.03e-6 SMART
Pumilio 678 713 5.48e-8 SMART
Pumilio 714 749 3.37e-8 SMART
Pumilio 750 785 6.29e-8 SMART
Pumilio 786 821 1.04e-8 SMART
Pumilio 822 857 6.2e-7 SMART
Pumilio 865 900 8.77e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105992
AA Change: S1016R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101613
Gene: ENSMUSG00000028580
AA Change: S1016R

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 297 318 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
low complexity region 379 406 N/A INTRINSIC
low complexity region 431 442 N/A INTRINSIC
low complexity region 487 518 N/A INTRINSIC
low complexity region 530 540 N/A INTRINSIC
low complexity region 546 569 N/A INTRINSIC
low complexity region 575 599 N/A INTRINSIC
low complexity region 634 644 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
Pumilio 752 787 1.75e-6 SMART
Pumilio 788 823 4.03e-6 SMART
Pumilio 824 858 5.24e-5 SMART
Pumilio 862 897 3.37e-8 SMART
Pumilio 898 933 6.29e-8 SMART
Pumilio 934 969 1.04e-8 SMART
Pumilio 970 1005 6.2e-7 SMART
Pumilio 1013 1048 8.77e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180943
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 93.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PUF family, evolutionarily conserved RNA-binding proteins related to the Pumilio proteins of Drosophila and the fem-3 mRNA binding factor proteins of C. elegans. The encoded protein contains a sequence-specific RNA binding domain comprised of eight repeats and N- and C-terminal flanking regions, and serves as a translational regulator of specific mRNAs by binding to their 3' untranslated regions. The evolutionarily conserved function of the encoded protein in invertebrates and lower vertebrates suggests that the human protein may be involved in translational regulation of embryogenesis, and cell development and differentiation. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testes weight and size, decreased body weight, oligozoospermia, reduced male fertility, increased male germ cell apoptosis and small seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,684,030 N690Y probably benign Het
Adcy5 A G 16: 35,279,237 E719G probably damaging Het
Ankdd1a A G 9: 65,516,938 M31T possibly damaging Het
Atp13a5 T C 16: 29,251,402 K911E possibly damaging Het
Bpifb3 G T 2: 153,924,808 L210F probably damaging Het
Cacna1c T C 6: 118,751,373 Y211C probably damaging Het
Carm1 C A 9: 21,583,077 P297T probably damaging Het
Cdh19 A T 1: 110,925,057 Y383N probably benign Het
Cfap221 T C 1: 119,932,853 H681R probably damaging Het
Cmya5 A C 13: 93,074,464 S3274A possibly damaging Het
Cndp2 T A 18: 84,675,078 K186* probably null Het
Ctdp1 G T 18: 80,451,255 F310L probably damaging Het
Cyp2c55 A T 19: 39,031,409 I264F probably damaging Het
Dhx40 A T 11: 86,773,823 F628I probably damaging Het
Disc1 T A 8: 125,135,389 M500K possibly damaging Het
Dnah5 A C 15: 28,349,824 D2551A possibly damaging Het
Esyt1 A G 10: 128,516,674 probably null Het
Fam78a T C 2: 32,082,831 S26G probably damaging Het
Fn1 G A 1: 71,647,844 probably null Het
Gbx1 T C 5: 24,504,918 T310A probably benign Het
Ggh T A 4: 20,042,219 C16S unknown Het
Gm11595 T A 11: 99,772,774 T27S unknown Het
Gm17334 T A 11: 53,772,738 probably benign Het
Gsk3b A G 16: 38,193,949 I256M probably damaging Het
Hmcn1 A T 1: 150,744,960 S1166R probably benign Het
Hyou1 T C 9: 44,382,025 probably null Het
Jup G T 11: 100,374,341 R637S probably benign Het
Lama2 T A 10: 27,053,031 I2087F possibly damaging Het
Lamc1 T G 1: 153,221,671 K1542N probably benign Het
Lgals4 G T 7: 28,840,692 Het
Lrrc8d A G 5: 105,811,760 D12G probably damaging Het
Lrwd1 C T 5: 136,133,034 V207M possibly damaging Het
Mbd1 T A 18: 74,273,691 probably null Het
Msi1 T A 5: 115,450,925 I333N probably damaging Het
Neo1 C T 9: 58,907,071 V871I probably benign Het
Nr2c1 T C 10: 94,188,216 C428R probably damaging Het
Ntm A G 9: 29,411,682 L14P probably damaging Het
Nxpe4 A T 9: 48,392,845 K77N probably damaging Het
Olfr1049 G A 2: 86,255,358 L112F probably benign Het
Olfr1224-ps1 T A 2: 89,157,161 S5C probably damaging Het
Olfr1293-ps T A 2: 111,527,656 M132K probably damaging Het
Olfr406 A C 11: 74,269,409 T7P possibly damaging Het
Olfr948 T C 9: 39,318,778 T279A possibly damaging Het
Pappa T A 4: 65,156,464 D418E probably damaging Het
Pde4d G A 13: 109,601,786 probably null Het
Pip A G 6: 41,851,457 N75S possibly damaging Het
Plcl1 G C 1: 55,697,252 R584P probably benign Het
Pnp A T 14: 50,951,014 D237V probably damaging Het
Ppp1r12a T C 10: 108,262,420 W857R probably damaging Het
Pramef12 T C 4: 144,393,083 T305A possibly damaging Het
Ptchd3 A T 11: 121,836,403 M368L probably benign Het
R3hdml A T 2: 163,502,404 S238C probably damaging Het
Robo2 G A 16: 74,046,809 R173* probably null Het
Sall3 A G 18: 80,973,187 S509P possibly damaging Het
Sap130 T G 18: 31,666,365 H298Q possibly damaging Het
Selenov C A 7: 28,288,033 G307C probably damaging Het
Setd2 T A 9: 110,550,385 H1089Q possibly damaging Het
Setdb2 T C 14: 59,419,056 N287D probably damaging Het
Sis C T 3: 72,958,174 V182I probably benign Het
Slc32a1 A C 2: 158,611,537 D99A probably benign Het
Slk A G 19: 47,620,888 D760G probably damaging Het
Smg5 T A 3: 88,351,220 D499E probably benign Het
Stat3 T C 11: 100,889,574 T720A possibly damaging Het
Trdn T G 10: 33,139,114 N21K probably damaging Het
Trpm4 A T 7: 45,326,568 V118E possibly damaging Het
Vgll3 A G 16: 65,815,754 Q41R probably damaging Het
Vmn1r189 A G 13: 22,102,355 V104A probably damaging Het
Vmn1r46 A T 6: 89,976,407 R79S probably benign Het
Zscan4c T C 7: 11,006,929 M125T probably benign Het
Other mutations in Pum1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Pum1 APN 4 130743789 missense probably damaging 1.00
IGL01327:Pum1 APN 4 130730543 missense probably damaging 0.97
IGL01360:Pum1 APN 4 130728170 intron probably benign
IGL02055:Pum1 APN 4 130754054 missense probably benign 0.19
IGL02713:Pum1 APN 4 130766012 missense probably damaging 1.00
IGL03401:Pum1 APN 4 130743681 splice site probably benign
LCD18:Pum1 UTSW 4 130730549 intron probably benign
R0077:Pum1 UTSW 4 130772674 missense probably benign 0.06
R0346:Pum1 UTSW 4 130779805 missense possibly damaging 0.74
R0632:Pum1 UTSW 4 130728104 missense probably benign 0.34
R0870:Pum1 UTSW 4 130768844 missense probably damaging 0.99
R1006:Pum1 UTSW 4 130771888 missense probably damaging 0.98
R1300:Pum1 UTSW 4 130765961 missense probably damaging 1.00
R1499:Pum1 UTSW 4 130719256 missense probably damaging 1.00
R1572:Pum1 UTSW 4 130718204 missense probably damaging 0.99
R1835:Pum1 UTSW 4 130701048 missense possibly damaging 0.93
R1864:Pum1 UTSW 4 130751525 missense possibly damaging 0.90
R1991:Pum1 UTSW 4 130718218 missense possibly damaging 0.93
R2068:Pum1 UTSW 4 130774434 missense probably benign 0.02
R2119:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2120:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2122:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2153:Pum1 UTSW 4 130751491 missense probably damaging 1.00
R2164:Pum1 UTSW 4 130728083 nonsense probably null
R2164:Pum1 UTSW 4 130728084 missense probably damaging 0.99
R2280:Pum1 UTSW 4 130766011 missense probably damaging 1.00
R3116:Pum1 UTSW 4 130772660 missense probably damaging 1.00
R3890:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R3891:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R3892:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R4134:Pum1 UTSW 4 130764069 missense probably damaging 1.00
R4258:Pum1 UTSW 4 130730280 missense probably damaging 1.00
R4731:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4732:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4733:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4973:Pum1 UTSW 4 130669137 missense probably benign 0.27
R5198:Pum1 UTSW 4 130779879 nonsense probably null
R5249:Pum1 UTSW 4 130762814 missense probably benign 0.07
R5478:Pum1 UTSW 4 130751484 missense possibly damaging 0.93
R5652:Pum1 UTSW 4 130764127 missense possibly damaging 0.95
R5932:Pum1 UTSW 4 130730366 missense probably benign 0.04
R6008:Pum1 UTSW 4 130768847 missense probably damaging 1.00
R6112:Pum1 UTSW 4 130730280 missense probably damaging 1.00
R6416:Pum1 UTSW 4 130728287 unclassified probably null
R6426:Pum1 UTSW 4 130753972 missense probably damaging 1.00
R7226:Pum1 UTSW 4 130771981 missense probably damaging 1.00
R7273:Pum1 UTSW 4 130751480 missense probably damaging 0.99
R7423:Pum1 UTSW 4 130774545 missense probably damaging 1.00
X0024:Pum1 UTSW 4 130779790 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACCCTGGGGAAATGAGTTC -3'
(R):5'- AGCAGAGACCACAGTGACTC -3'

Sequencing Primer
(F):5'- GAAATGAGTTCCCTCCCTATGTGTG -3'
(R):5'- GTGACTCCACACAGGACGAG -3'
Posted On2018-05-24