Incidental Mutation 'R6431:Neo1'
ID518543
Institutional Source Beutler Lab
Gene Symbol Neo1
Ensembl Gene ENSMUSG00000032340
Gene Nameneogenin
Synonyms2610028H22Rik, D930014N22Rik, Igdcc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6431 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location58874687-59036441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58907071 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 871 (V871I)
Ref Sequence ENSEMBL: ENSMUSP00000063656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068664] [ENSMUST00000214547]
Predicted Effect probably benign
Transcript: ENSMUST00000068664
AA Change: V871I

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000063656
Gene: ENSMUSG00000032340
AA Change: V871I

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
IGc2 76 147 9.49e-5 SMART
IGc2 175 239 4.43e-5 SMART
IGc2 272 338 6.15e-13 SMART
IGc2 364 428 7.76e-10 SMART
low complexity region 446 458 N/A INTRINSIC
FN3 470 553 8.23e-12 SMART
FN3 570 649 1.78e-16 SMART
FN3 665 749 1.54e-11 SMART
FN3 770 849 5.27e-10 SMART
FN3 885 970 7.63e-7 SMART
FN3 986 1072 2.78e-9 SMART
transmembrane domain 1136 1158 N/A INTRINSIC
Pfam:Neogenin_C 1189 1492 1.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214547
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 93.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface protein that is a member of the immunoglobulin superfamily. The encoded protein consists of four N-terminal immunoglobulin-like domains, six fibronectin type III domains, a transmembrane domain and a C-terminal internal domain that shares homology with the tumor suppressor candidate gene DCC. This protein may be involved in cell growth and differentiation and in cell-cell adhesion. Defects in this gene are associated with cell proliferation in certain cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display perinatal lethality and abnormal trigeminal nerve development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,684,030 N690Y probably benign Het
Adcy5 A G 16: 35,279,237 E719G probably damaging Het
Ankdd1a A G 9: 65,516,938 M31T possibly damaging Het
Atp13a5 T C 16: 29,251,402 K911E possibly damaging Het
Bpifb3 G T 2: 153,924,808 L210F probably damaging Het
Cacna1c T C 6: 118,751,373 Y211C probably damaging Het
Carm1 C A 9: 21,583,077 P297T probably damaging Het
Cdh19 A T 1: 110,925,057 Y383N probably benign Het
Cfap221 T C 1: 119,932,853 H681R probably damaging Het
Cmya5 A C 13: 93,074,464 S3274A possibly damaging Het
Cndp2 T A 18: 84,675,078 K186* probably null Het
Ctdp1 G T 18: 80,451,255 F310L probably damaging Het
Cyp2c55 A T 19: 39,031,409 I264F probably damaging Het
Dhx40 A T 11: 86,773,823 F628I probably damaging Het
Disc1 T A 8: 125,135,389 M500K possibly damaging Het
Dnah5 A C 15: 28,349,824 D2551A possibly damaging Het
Esyt1 A G 10: 128,516,674 probably null Het
Fam78a T C 2: 32,082,831 S26G probably damaging Het
Fn1 G A 1: 71,647,844 probably null Het
Gbx1 T C 5: 24,504,918 T310A probably benign Het
Ggh T A 4: 20,042,219 C16S unknown Het
Gm11595 T A 11: 99,772,774 T27S unknown Het
Gm17334 T A 11: 53,772,738 probably benign Het
Gsk3b A G 16: 38,193,949 I256M probably damaging Het
Hmcn1 A T 1: 150,744,960 S1166R probably benign Het
Hyou1 T C 9: 44,382,025 probably null Het
Jup G T 11: 100,374,341 R637S probably benign Het
Lama2 T A 10: 27,053,031 I2087F possibly damaging Het
Lamc1 T G 1: 153,221,671 K1542N probably benign Het
Lgals4 G T 7: 28,840,692 Het
Lrrc8d A G 5: 105,811,760 D12G probably damaging Het
Lrwd1 C T 5: 136,133,034 V207M possibly damaging Het
Mbd1 T A 18: 74,273,691 probably null Het
Msi1 T A 5: 115,450,925 I333N probably damaging Het
Nr2c1 T C 10: 94,188,216 C428R probably damaging Het
Ntm A G 9: 29,411,682 L14P probably damaging Het
Nxpe4 A T 9: 48,392,845 K77N probably damaging Het
Olfr1049 G A 2: 86,255,358 L112F probably benign Het
Olfr1224-ps1 T A 2: 89,157,161 S5C probably damaging Het
Olfr1293-ps T A 2: 111,527,656 M132K probably damaging Het
Olfr406 A C 11: 74,269,409 T7P possibly damaging Het
Olfr948 T C 9: 39,318,778 T279A possibly damaging Het
Pappa T A 4: 65,156,464 D418E probably damaging Het
Pde4d G A 13: 109,601,786 probably null Het
Pip A G 6: 41,851,457 N75S possibly damaging Het
Plcl1 G C 1: 55,697,252 R584P probably benign Het
Pnp A T 14: 50,951,014 D237V probably damaging Het
Ppp1r12a T C 10: 108,262,420 W857R probably damaging Het
Pramef12 T C 4: 144,393,083 T305A possibly damaging Het
Ptchd3 A T 11: 121,836,403 M368L probably benign Het
Pum1 T A 4: 130,774,505 S868R probably damaging Het
R3hdml A T 2: 163,502,404 S238C probably damaging Het
Robo2 G A 16: 74,046,809 R173* probably null Het
Sall3 A G 18: 80,973,187 S509P possibly damaging Het
Sap130 T G 18: 31,666,365 H298Q possibly damaging Het
Selenov C A 7: 28,288,033 G307C probably damaging Het
Setd2 T A 9: 110,550,385 H1089Q possibly damaging Het
Setdb2 T C 14: 59,419,056 N287D probably damaging Het
Sis C T 3: 72,958,174 V182I probably benign Het
Slc32a1 A C 2: 158,611,537 D99A probably benign Het
Slk A G 19: 47,620,888 D760G probably damaging Het
Smg5 T A 3: 88,351,220 D499E probably benign Het
Stat3 T C 11: 100,889,574 T720A possibly damaging Het
Trdn T G 10: 33,139,114 N21K probably damaging Het
Trpm4 A T 7: 45,326,568 V118E possibly damaging Het
Vgll3 A G 16: 65,815,754 Q41R probably damaging Het
Vmn1r189 A G 13: 22,102,355 V104A probably damaging Het
Vmn1r46 A T 6: 89,976,407 R79S probably benign Het
Zscan4c T C 7: 11,006,929 M125T probably benign Het
Other mutations in Neo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Neo1 APN 9 58921919 splice site probably benign
IGL00885:Neo1 APN 9 58888463 missense probably damaging 1.00
IGL01103:Neo1 APN 9 58880799 missense possibly damaging 0.60
IGL01322:Neo1 APN 9 58907085 missense possibly damaging 0.68
IGL02216:Neo1 APN 9 58917053 missense probably damaging 0.96
IGL02327:Neo1 APN 9 58903088 missense probably benign 0.08
IGL02392:Neo1 APN 9 58925811 missense possibly damaging 0.49
IGL02458:Neo1 APN 9 58893867 splice site probably benign
IGL03057:Neo1 APN 9 58878059 missense probably damaging 1.00
IGL03091:Neo1 APN 9 58978668 missense probably damaging 0.98
IGL03193:Neo1 APN 9 58908484 missense probably damaging 1.00
R0097:Neo1 UTSW 9 58882021 intron probably benign
R0419:Neo1 UTSW 9 58990180 splice site probably benign
R0571:Neo1 UTSW 9 58985786 missense probably benign
R0646:Neo1 UTSW 9 58931034 missense probably damaging 1.00
R0736:Neo1 UTSW 9 58917081 missense possibly damaging 0.78
R0739:Neo1 UTSW 9 58921877 missense probably benign 0.22
R1636:Neo1 UTSW 9 58913277 missense probably damaging 1.00
R1694:Neo1 UTSW 9 58880603 missense probably damaging 1.00
R1827:Neo1 UTSW 9 58917031 nonsense probably null
R1927:Neo1 UTSW 9 58990385 missense probably benign 0.12
R2354:Neo1 UTSW 9 58985634 missense probably benign
R2365:Neo1 UTSW 9 58956003 missense probably benign
R3156:Neo1 UTSW 9 58888979 splice site probably null
R3552:Neo1 UTSW 9 58893878 missense probably damaging 1.00
R3829:Neo1 UTSW 9 58913169 missense possibly damaging 0.58
R4477:Neo1 UTSW 9 58877299 missense probably damaging 0.99
R4613:Neo1 UTSW 9 58889041 missense possibly damaging 0.94
R5023:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5046:Neo1 UTSW 9 58893911 missense possibly damaging 0.77
R5057:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5323:Neo1 UTSW 9 58906648 critical splice donor site probably null
R5394:Neo1 UTSW 9 58990234 missense probably benign 0.10
R5470:Neo1 UTSW 9 58931067 missense probably damaging 1.00
R5473:Neo1 UTSW 9 58880843 missense possibly damaging 0.88
R5500:Neo1 UTSW 9 58917054 missense possibly damaging 0.94
R5503:Neo1 UTSW 9 58985650 missense possibly damaging 0.67
R6122:Neo1 UTSW 9 58917008 missense probably benign
R6191:Neo1 UTSW 9 58889029 missense probably damaging 1.00
R6560:Neo1 UTSW 9 58880601 missense possibly damaging 0.95
R6658:Neo1 UTSW 9 58921849 missense probably benign 0.14
R6772:Neo1 UTSW 9 58902976 missense probably damaging 1.00
R6912:Neo1 UTSW 9 58917052 missense probably benign 0.00
R7061:Neo1 UTSW 9 58990441 missense possibly damaging 0.95
R7145:Neo1 UTSW 9 58889179 missense probably damaging 1.00
R7156:Neo1 UTSW 9 58902923 missense probably damaging 1.00
X0063:Neo1 UTSW 9 58990298 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAAGGCAAATGTTCAGTACCTTG -3'
(R):5'- GTGCTCTTCTGAATGAATGAGGGC -3'

Sequencing Primer
(F):5'- GGCAAATGTTCAGTACCTTGTACTTC -3'
(R):5'- GAATGAGGGCTATCTATTAACTCTGG -3'
Posted On2018-05-24