Incidental Mutation 'R6432:Tram2'
ID518575
Institutional Source Beutler Lab
Gene Symbol Tram2
Ensembl Gene ENSMUSG00000041779
Gene Nametranslocating chain-associating membrane protein 2
SynonymsC330003D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6432 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location20996299-21079229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21004233 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 242 (E242K)
Ref Sequence ENSEMBL: ENSMUSP00000047992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037998]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037998
AA Change: E242K

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047992
Gene: ENSMUSG00000041779
AA Change: E242K

DomainStartEndE-ValueType
Pfam:TRAM1 46 110 1.3e-22 PFAM
TLC 112 321 4.2e-60 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187210
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TRAM2 is a component of the translocon, a gated macromolecular channel that controls the posttranslational processing of nascent secretory and membrane proteins at the endoplasmic reticulum (ER) membrane.[supplied by OMIM, Jul 2004]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik T C 15: 74,879,964 T74A probably benign Het
5430419D17Rik G A 7: 131,244,872 probably null Het
Adora3 T A 3: 105,907,675 L101* probably null Het
Atf7ip2 T C 16: 10,204,670 I71T probably damaging Het
Atp2c1 A G 9: 105,445,313 C206R probably damaging Het
Cacna1d A G 14: 30,123,454 L606P probably damaging Het
Cass4 T C 2: 172,427,719 F574L probably damaging Het
Col17a1 C A 19: 47,680,408 E126* probably null Het
Cxadr A C 16: 78,325,259 D49A probably damaging Het
Dact1 T C 12: 71,318,553 S703P probably damaging Het
Dchs2 T A 3: 83,271,118 H1159Q possibly damaging Het
Dnmt3a T A 12: 3,902,399 F697I probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Ear2 G T 14: 44,103,203 C106F probably damaging Het
Gnl2 A T 4: 125,052,560 I525F possibly damaging Het
Hsph1 C A 5: 149,618,976 K692N probably damaging Het
Itga6 T A 2: 71,833,772 C489S possibly damaging Het
Kdm2b C T 5: 122,880,191 C1007Y probably damaging Het
Mast4 T C 13: 102,905,677 S22G possibly damaging Het
Ms4a12 A G 19: 11,215,012 *264Q probably null Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Ncapd3 T A 9: 27,044,509 N131K probably damaging Het
Olfr1136 A T 2: 87,693,528 M118K probably damaging Het
Olfr981 T C 9: 40,022,528 I45T probably damaging Het
Rbm14 G T 19: 4,803,163 probably benign Het
Rnf130 T A 11: 50,095,790 C320* probably null Het
Rnf5 A G 17: 34,602,127 V77A possibly damaging Het
Sh3pxd2a G T 19: 47,269,927 P418T probably damaging Het
Shank3 G T 15: 89,503,413 V262F possibly damaging Het
Six5 T A 7: 19,096,771 V441E probably damaging Het
Tbc1d9b T A 11: 50,146,328 I268N probably benign Het
Terb1 G A 8: 104,485,446 T301I possibly damaging Het
Tnxb A C 17: 34,717,917 D2820A probably damaging Het
Trps1 T C 15: 50,831,397 K210E probably damaging Het
Tulp2 T A 7: 45,518,588 D141E probably benign Het
Umodl1 C T 17: 30,986,147 T572I probably benign Het
Upf2 C A 2: 5,979,777 A501E unknown Het
Vmn2r102 A G 17: 19,681,221 T537A possibly damaging Het
Wdr11 T A 7: 129,606,518 D332E possibly damaging Het
Wdr38 A G 2: 39,000,711 N199S probably damaging Het
Zfp672 T A 11: 58,316,932 I188F possibly damaging Het
Other mutations in Tram2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01860:Tram2 APN 1 21003859 missense possibly damaging 0.90
R0057:Tram2 UTSW 1 21006154 missense probably damaging 0.98
R0299:Tram2 UTSW 1 21004244 missense probably damaging 0.99
R1633:Tram2 UTSW 1 21003922 missense probably damaging 0.99
R1703:Tram2 UTSW 1 21004234 missense probably damaging 0.96
R2032:Tram2 UTSW 1 21003956 missense probably null 0.98
R3690:Tram2 UTSW 1 21005600 missense probably damaging 1.00
R3859:Tram2 UTSW 1 21003980 missense probably damaging 1.00
R4583:Tram2 UTSW 1 21013449 missense probably benign 0.01
R6022:Tram2 UTSW 1 21079137 start gained probably benign
X0058:Tram2 UTSW 1 21079103 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGAAGCAACCCAGAGTG -3'
(R):5'- AAGCACTGTCCCGCAAGAAG -3'

Sequencing Primer
(F):5'- CCAGAGTGGGAAAGAGCATC -3'
(R):5'- ACAGAGAGCAGCCTGAGC -3'
Posted On2018-05-24