Incidental Mutation 'R6432:Olfr1136'
ID518580
Institutional Source Beutler Lab
Gene Symbol Olfr1136
Ensembl Gene ENSMUSG00000075151
Gene Nameolfactory receptor 1136
SynonymsMOR177-3, GA_x6K02T2Q125-49193051-49192119
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6432 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87692881-87693947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87693528 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 118 (M118K)
Ref Sequence ENSEMBL: ENSMUSP00000076681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077471] [ENSMUST00000099852]
Predicted Effect probably damaging
Transcript: ENSMUST00000077471
AA Change: M118K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076681
Gene: ENSMUSG00000075151
AA Change: M118K

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 6e-48 PFAM
Pfam:7tm_1 40 289 2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099852
AA Change: M118K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097438
Gene: ENSMUSG00000068815
AA Change: M118K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2e-41 PFAM
Pfam:7tm_1 41 290 4.3e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik T C 15: 74,879,964 T74A probably benign Het
5430419D17Rik G A 7: 131,244,872 probably null Het
Adora3 T A 3: 105,907,675 L101* probably null Het
Atf7ip2 T C 16: 10,204,670 I71T probably damaging Het
Atp2c1 A G 9: 105,445,313 C206R probably damaging Het
Cacna1d A G 14: 30,123,454 L606P probably damaging Het
Cass4 T C 2: 172,427,719 F574L probably damaging Het
Col17a1 C A 19: 47,680,408 E126* probably null Het
Cxadr A C 16: 78,325,259 D49A probably damaging Het
Dact1 T C 12: 71,318,553 S703P probably damaging Het
Dchs2 T A 3: 83,271,118 H1159Q possibly damaging Het
Dnmt3a T A 12: 3,902,399 F697I probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Ear2 G T 14: 44,103,203 C106F probably damaging Het
Gnl2 A T 4: 125,052,560 I525F possibly damaging Het
Hsph1 C A 5: 149,618,976 K692N probably damaging Het
Itga6 T A 2: 71,833,772 C489S possibly damaging Het
Kdm2b C T 5: 122,880,191 C1007Y probably damaging Het
Mast4 T C 13: 102,905,677 S22G possibly damaging Het
Ms4a12 A G 19: 11,215,012 *264Q probably null Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Ncapd3 T A 9: 27,044,509 N131K probably damaging Het
Olfr981 T C 9: 40,022,528 I45T probably damaging Het
Rbm14 G T 19: 4,803,163 probably benign Het
Rnf130 T A 11: 50,095,790 C320* probably null Het
Rnf5 A G 17: 34,602,127 V77A possibly damaging Het
Sh3pxd2a G T 19: 47,269,927 P418T probably damaging Het
Shank3 G T 15: 89,503,413 V262F possibly damaging Het
Six5 T A 7: 19,096,771 V441E probably damaging Het
Tbc1d9b T A 11: 50,146,328 I268N probably benign Het
Terb1 G A 8: 104,485,446 T301I possibly damaging Het
Tnxb A C 17: 34,717,917 D2820A probably damaging Het
Tram2 C T 1: 21,004,233 E242K possibly damaging Het
Trps1 T C 15: 50,831,397 K210E probably damaging Het
Tulp2 T A 7: 45,518,588 D141E probably benign Het
Umodl1 C T 17: 30,986,147 T572I probably benign Het
Upf2 C A 2: 5,979,777 A501E unknown Het
Vmn2r102 A G 17: 19,681,221 T537A possibly damaging Het
Wdr11 T A 7: 129,606,518 D332E possibly damaging Het
Wdr38 A G 2: 39,000,711 N199S probably damaging Het
Zfp672 T A 11: 58,316,932 I188F possibly damaging Het
Other mutations in Olfr1136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01809:Olfr1136 APN 2 87693745 missense possibly damaging 0.73
IGL02190:Olfr1136 APN 2 87693063 missense probably benign 0.21
IGL02902:Olfr1136 APN 2 87693000 missense probably damaging 1.00
R0153:Olfr1136 UTSW 2 87693604 missense probably benign 0.05
R0665:Olfr1136 UTSW 2 87693808 missense probably benign 0.00
R1462:Olfr1136 UTSW 2 87693376 missense probably damaging 1.00
R1462:Olfr1136 UTSW 2 87693376 missense probably damaging 1.00
R1518:Olfr1136 UTSW 2 87693528 missense probably damaging 1.00
R1812:Olfr1136 UTSW 2 87693103 missense probably benign 0.01
R1993:Olfr1136 UTSW 2 87693433 missense probably benign 0.07
R2098:Olfr1136 UTSW 2 87693729 missense probably benign 0.25
R3106:Olfr1136 UTSW 2 87693505 missense probably damaging 0.98
R4622:Olfr1136 UTSW 2 87693643 nonsense probably null
R4694:Olfr1136 UTSW 2 87693760 missense probably benign 0.03
R5079:Olfr1136 UTSW 2 87693208 missense probably damaging 0.99
R5474:Olfr1136 UTSW 2 87693057 missense probably damaging 1.00
R6667:Olfr1136 UTSW 2 87693570 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCTGAGATGGTGCTTAGTTC -3'
(R):5'- TGGATCCCCAGCTTCACATAC -3'

Sequencing Primer
(F):5'- GAGATGGTGCTTAGTTCAATGAAACC -3'
(R):5'- CCAGCTTCACATACCAATGTATTTC -3'
Posted On2018-05-24