Incidental Mutation 'R6432:Hsph1'
ID518586
Institutional Source Beutler Lab
Gene Symbol Hsph1
Ensembl Gene ENSMUSG00000029657
Gene Nameheat shock 105kDa/110kDa protein 1
SynonymsHsp105, hsp-E7I, HSP110
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R6432 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location149614287-149636376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 149618976 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 692 (K692N)
Ref Sequence ENSEMBL: ENSMUSP00000144413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074846] [ENSMUST00000201452] [ENSMUST00000202089] [ENSMUST00000202361]
Predicted Effect probably damaging
Transcript: ENSMUST00000074846
AA Change: K648N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074392
Gene: ENSMUSG00000029657
AA Change: K648N

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201431
Predicted Effect probably damaging
Transcript: ENSMUST00000201452
AA Change: K692N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144654
Gene: ENSMUSG00000029657
AA Change: K692N

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201877
Predicted Effect probably damaging
Transcript: ENSMUST00000202089
AA Change: K651N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144297
Gene: ENSMUSG00000029657
AA Change: K651N

DomainStartEndE-ValueType
Pfam:HSP70 3 103 1.3e-33 PFAM
Pfam:HSP70 98 668 8.5e-135 PFAM
low complexity region 715 727 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202137
Predicted Effect probably damaging
Transcript: ENSMUST00000202361
AA Change: K692N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144413
Gene: ENSMUSG00000029657
AA Change: K692N

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene leads to decreased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik T C 15: 74,879,964 T74A probably benign Het
5430419D17Rik G A 7: 131,244,872 probably null Het
Adora3 T A 3: 105,907,675 L101* probably null Het
Atf7ip2 T C 16: 10,204,670 I71T probably damaging Het
Atp2c1 A G 9: 105,445,313 C206R probably damaging Het
Cacna1d A G 14: 30,123,454 L606P probably damaging Het
Cass4 T C 2: 172,427,719 F574L probably damaging Het
Col17a1 C A 19: 47,680,408 E126* probably null Het
Cxadr A C 16: 78,325,259 D49A probably damaging Het
Dact1 T C 12: 71,318,553 S703P probably damaging Het
Dchs2 T A 3: 83,271,118 H1159Q possibly damaging Het
Dnmt3a T A 12: 3,902,399 F697I probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Ear2 G T 14: 44,103,203 C106F probably damaging Het
Gnl2 A T 4: 125,052,560 I525F possibly damaging Het
Itga6 T A 2: 71,833,772 C489S possibly damaging Het
Kdm2b C T 5: 122,880,191 C1007Y probably damaging Het
Mast4 T C 13: 102,905,677 S22G possibly damaging Het
Ms4a12 A G 19: 11,215,012 *264Q probably null Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Ncapd3 T A 9: 27,044,509 N131K probably damaging Het
Olfr1136 A T 2: 87,693,528 M118K probably damaging Het
Olfr981 T C 9: 40,022,528 I45T probably damaging Het
Rbm14 G T 19: 4,803,163 probably benign Het
Rnf130 T A 11: 50,095,790 C320* probably null Het
Rnf5 A G 17: 34,602,127 V77A possibly damaging Het
Sh3pxd2a G T 19: 47,269,927 P418T probably damaging Het
Shank3 G T 15: 89,503,413 V262F possibly damaging Het
Six5 T A 7: 19,096,771 V441E probably damaging Het
Tbc1d9b T A 11: 50,146,328 I268N probably benign Het
Terb1 G A 8: 104,485,446 T301I possibly damaging Het
Tnxb A C 17: 34,717,917 D2820A probably damaging Het
Tram2 C T 1: 21,004,233 E242K possibly damaging Het
Trps1 T C 15: 50,831,397 K210E probably damaging Het
Tulp2 T A 7: 45,518,588 D141E probably benign Het
Umodl1 C T 17: 30,986,147 T572I probably benign Het
Upf2 C A 2: 5,979,777 A501E unknown Het
Vmn2r102 A G 17: 19,681,221 T537A possibly damaging Het
Wdr11 T A 7: 129,606,518 D332E possibly damaging Het
Wdr38 A G 2: 39,000,711 N199S probably damaging Het
Zfp672 T A 11: 58,316,932 I188F possibly damaging Het
Other mutations in Hsph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Hsph1 APN 5 149618789 missense possibly damaging 0.95
IGL00839:Hsph1 APN 5 149618454 missense possibly damaging 0.47
IGL00965:Hsph1 APN 5 149630804 missense probably damaging 1.00
IGL01529:Hsph1 APN 5 149636034 missense probably benign 0.01
IGL01613:Hsph1 APN 5 149627278 missense probably benign 0.34
IGL02023:Hsph1 APN 5 149633859 missense probably damaging 1.00
IGL02272:Hsph1 APN 5 149617530 missense probably benign 0.00
IGL02754:Hsph1 APN 5 149623592 missense possibly damaging 0.95
R0666:Hsph1 UTSW 5 149631502 missense probably damaging 1.00
R1061:Hsph1 UTSW 5 149618418 missense possibly damaging 0.93
R1163:Hsph1 UTSW 5 149630801 missense probably damaging 1.00
R1511:Hsph1 UTSW 5 149630383 missense probably benign 0.03
R1794:Hsph1 UTSW 5 149630773 missense probably damaging 1.00
R1806:Hsph1 UTSW 5 149629989 missense probably damaging 0.99
R1847:Hsph1 UTSW 5 149623485 nonsense probably null
R2143:Hsph1 UTSW 5 149631486 missense probably damaging 0.99
R2144:Hsph1 UTSW 5 149630337 critical splice donor site probably null
R2917:Hsph1 UTSW 5 149630786 nonsense probably null
R3840:Hsph1 UTSW 5 149620715 intron probably null
R3841:Hsph1 UTSW 5 149620715 intron probably null
R4378:Hsph1 UTSW 5 149636007 nonsense probably null
R4577:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R4618:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R4621:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R5898:Hsph1 UTSW 5 149625158 missense probably damaging 1.00
R6114:Hsph1 UTSW 5 149627387 missense possibly damaging 0.53
R6185:Hsph1 UTSW 5 149617695 missense probably damaging 1.00
R6678:Hsph1 UTSW 5 149618497 missense probably benign 0.00
R7014:Hsph1 UTSW 5 149630400 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGCTGCAATCTTGGCATAG -3'
(R):5'- TGAACTACCTGGGGTCACTG -3'

Sequencing Primer
(F):5'- CAATCTTGGCATAGTGCTGCAG -3'
(R):5'- TCACTGCGGAAATGCGTG -3'
Posted On2018-05-24