Incidental Mutation 'R6432:Ms4a12'
ID518614
Institutional Source Beutler Lab
Gene Symbol Ms4a12
Ensembl Gene ENSMUSG00000101031
Gene Namemembrane-spanning 4-domains, subfamily A, member 12
SynonymsLOC381213
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6432 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location11215010-11230540 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 11215012 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 264 (*264Q)
Ref Sequence ENSEMBL: ENSMUSP00000140981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186228]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181137
Predicted Effect probably null
Transcript: ENSMUST00000186228
AA Change: *264Q
SMART Domains Protein: ENSMUSP00000140981
Gene: ENSMUSG00000101031
AA Change: *264Q

DomainStartEndE-ValueType
Pfam:CD20 85 220 9.6e-24 PFAM
low complexity region 230 241 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell surface protein found primarily in the apical membrane of colonocytes. Silencing of this gene in colon cancer cells inhibits the proliferation, cell motility, and chemotactic invasion of cells. This gene is part of a cluster of similar genes found on chromosome 11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik T C 15: 74,879,964 T74A probably benign Het
5430419D17Rik G A 7: 131,244,872 probably null Het
Adora3 T A 3: 105,907,675 L101* probably null Het
Atf7ip2 T C 16: 10,204,670 I71T probably damaging Het
Atp2c1 A G 9: 105,445,313 C206R probably damaging Het
Cacna1d A G 14: 30,123,454 L606P probably damaging Het
Cass4 T C 2: 172,427,719 F574L probably damaging Het
Col17a1 C A 19: 47,680,408 E126* probably null Het
Cxadr A C 16: 78,325,259 D49A probably damaging Het
Dact1 T C 12: 71,318,553 S703P probably damaging Het
Dchs2 T A 3: 83,271,118 H1159Q possibly damaging Het
Dnmt3a T A 12: 3,902,399 F697I probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Ear2 G T 14: 44,103,203 C106F probably damaging Het
Gnl2 A T 4: 125,052,560 I525F possibly damaging Het
Hsph1 C A 5: 149,618,976 K692N probably damaging Het
Itga6 T A 2: 71,833,772 C489S possibly damaging Het
Kdm2b C T 5: 122,880,191 C1007Y probably damaging Het
Mast4 T C 13: 102,905,677 S22G possibly damaging Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Ncapd3 T A 9: 27,044,509 N131K probably damaging Het
Olfr1136 A T 2: 87,693,528 M118K probably damaging Het
Olfr981 T C 9: 40,022,528 I45T probably damaging Het
Rbm14 G T 19: 4,803,163 probably benign Het
Rnf130 T A 11: 50,095,790 C320* probably null Het
Rnf5 A G 17: 34,602,127 V77A possibly damaging Het
Sh3pxd2a G T 19: 47,269,927 P418T probably damaging Het
Shank3 G T 15: 89,503,413 V262F possibly damaging Het
Six5 T A 7: 19,096,771 V441E probably damaging Het
Tbc1d9b T A 11: 50,146,328 I268N probably benign Het
Terb1 G A 8: 104,485,446 T301I possibly damaging Het
Tnxb A C 17: 34,717,917 D2820A probably damaging Het
Tram2 C T 1: 21,004,233 E242K possibly damaging Het
Trps1 T C 15: 50,831,397 K210E probably damaging Het
Tulp2 T A 7: 45,518,588 D141E probably benign Het
Umodl1 C T 17: 30,986,147 T572I probably benign Het
Upf2 C A 2: 5,979,777 A501E unknown Het
Vmn2r102 A G 17: 19,681,221 T537A possibly damaging Het
Wdr11 T A 7: 129,606,518 D332E possibly damaging Het
Wdr38 A G 2: 39,000,711 N199S probably damaging Het
Zfp672 T A 11: 58,316,932 I188F possibly damaging Het
Other mutations in Ms4a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4412:Ms4a12 UTSW 19 11230443 missense probably benign 0.00
R6114:Ms4a12 UTSW 19 11215290 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ATTGCAGTAATGGTAAGCAGTTGG -3'
(R):5'- TGACTACTGAGCTCTCTGCC -3'

Sequencing Primer
(F):5'- GGCAGGGAGGCACTGAC -3'
(R):5'- CCTCCACTCTGCTGGGAC -3'
Posted On2018-05-24