Incidental Mutation 'R6434:Inpp4a'
ID518673
Institutional Source Beutler Lab
Gene Symbol Inpp4a
Ensembl Gene ENSMUSG00000026113
Gene Nameinositol polyphosphate-4-phosphatase, type I
Synonyms107kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R6434 (G1)
Quality Score150.008
Status Validated
Chromosome1
Chromosomal Location37299865-37410736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37398838 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 593 (T593A)
Ref Sequence ENSEMBL: ENSMUSP00000130443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027287] [ENSMUST00000058307] [ENSMUST00000114933] [ENSMUST00000132401] [ENSMUST00000132615] [ENSMUST00000136846] [ENSMUST00000137266] [ENSMUST00000140264] [ENSMUST00000168546] [ENSMUST00000193774]
Predicted Effect probably damaging
Transcript: ENSMUST00000027287
AA Change: T869A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027287
Gene: ENSMUSG00000026113
AA Change: T869A

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 565 590 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058307
AA Change: T593A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057233
Gene: ENSMUSG00000026113
AA Change: T593A

DomainStartEndE-ValueType
transmembrane domain 651 673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114933
AA Change: T604A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110583
Gene: ENSMUSG00000026113
AA Change: T604A

DomainStartEndE-ValueType
low complexity region 300 325 N/A INTRINSIC
transmembrane domain 662 684 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132401
AA Change: T902A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123071
Gene: ENSMUSG00000026113
AA Change: T902A

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 6e-5 SMART
low complexity region 602 623 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132615
AA Change: T868A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115249
Gene: ENSMUSG00000026113
AA Change: T868A

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 565 590 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136846
AA Change: T868A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121518
Gene: ENSMUSG00000026113
AA Change: T868A

DomainStartEndE-ValueType
Blast:C2 49 142 9e-58 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 559 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137266
AA Change: T907A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121803
Gene: ENSMUSG00000026113
AA Change: T907A

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 6e-5 SMART
low complexity region 377 391 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140264
AA Change: T863A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121107
Gene: ENSMUSG00000026113
AA Change: T863A

DomainStartEndE-ValueType
Blast:C2 49 142 7e-58 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 377 391 N/A INTRINSIC
low complexity region 564 589 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168546
AA Change: T593A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130443
Gene: ENSMUSG00000026113
AA Change: T593A

DomainStartEndE-ValueType
transmembrane domain 651 673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193774
AA Change: T236A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142118
Gene: ENSMUSG00000026113
AA Change: T236A

DomainStartEndE-ValueType
Blast:C2 45 87 7e-13 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Mg++ independent enzyme that hydrolyzes the 4-position phosphate from the inositol ring of phosphatidylinositol 3,4-bisphosphate, inositol 1,3,4-trisphosphate, and inositol 3,4-bisphosphate. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit small size, ataxia, loss of cerebellar and hippocampal CA1 neurons, and death by 24 days of age from seizures and/or malnutrition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Inpp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Inpp4a APN 1 37388905 missense probably damaging 1.00
IGL01821:Inpp4a APN 1 37377717 missense probably damaging 1.00
IGL02015:Inpp4a APN 1 37389712 missense probably damaging 1.00
IGL02036:Inpp4a APN 1 37377569 intron probably benign
IGL02040:Inpp4a APN 1 37396085 missense probably damaging 0.99
IGL02082:Inpp4a APN 1 37366627 intron probably benign
IGL02318:Inpp4a APN 1 37368303 missense probably damaging 1.00
IGL02555:Inpp4a APN 1 37379968 missense possibly damaging 0.70
IGL02622:Inpp4a APN 1 37379034 missense probably benign 0.26
R0265:Inpp4a UTSW 1 37378986 missense probably damaging 1.00
R0388:Inpp4a UTSW 1 37396160 missense probably damaging 0.96
R0543:Inpp4a UTSW 1 37369492 intron probably benign
R1269:Inpp4a UTSW 1 37389742 missense probably benign 0.01
R1719:Inpp4a UTSW 1 37398799 missense probably damaging 1.00
R1799:Inpp4a UTSW 1 37392978 missense possibly damaging 0.56
R2127:Inpp4a UTSW 1 37366919 missense probably benign 0.08
R2143:Inpp4a UTSW 1 37387746 missense probably damaging 1.00
R2174:Inpp4a UTSW 1 37396130 missense probably damaging 1.00
R2258:Inpp4a UTSW 1 37377696 missense probably damaging 1.00
R2327:Inpp4a UTSW 1 37366166 missense probably damaging 0.96
R2437:Inpp4a UTSW 1 37392956 missense probably damaging 1.00
R2897:Inpp4a UTSW 1 37366594 missense probably benign 0.07
R2898:Inpp4a UTSW 1 37366594 missense probably benign 0.07
R4830:Inpp4a UTSW 1 37371780 missense probably damaging 1.00
R4934:Inpp4a UTSW 1 37387841 missense possibly damaging 0.74
R5141:Inpp4a UTSW 1 37380087 missense probably benign 0.17
R5152:Inpp4a UTSW 1 37358535 missense possibly damaging 0.88
R5627:Inpp4a UTSW 1 37367773 missense probably damaging 0.96
R5789:Inpp4a UTSW 1 37372329 missense possibly damaging 0.75
R6004:Inpp4a UTSW 1 37372370 missense probably damaging 0.99
R6107:Inpp4a UTSW 1 37377748 missense probably damaging 0.98
R6180:Inpp4a UTSW 1 37380102 missense probably benign
R6571:Inpp4a UTSW 1 37387758 missense probably damaging 1.00
R6766:Inpp4a UTSW 1 37372341 missense probably damaging 1.00
R6992:Inpp4a UTSW 1 37389691 missense probably damaging 0.98
R7025:Inpp4a UTSW 1 37369423 missense probably benign 0.00
R7126:Inpp4a UTSW 1 37374272 missense probably benign 0.00
R7473:Inpp4a UTSW 1 37369453 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CAGTCAGGCTAGGAATAGGC -3'
(R):5'- ACTCAAGTGTGCTGGAAGTCTG -3'

Sequencing Primer
(F):5'- ATTATTTTATTGTTGGTGTTCCTGCC -3'
(R):5'- AAGTCTGGGCCCCATGTG -3'
Posted On2018-05-24