Incidental Mutation 'R6434:Olfr862'
ID518702
Institutional Source Beutler Lab
Gene Symbol Olfr862
Ensembl Gene ENSMUSG00000063842
Gene Nameolfactory receptor 862
SynonymsGA_x6K02T2PVTD-13624132-13623212, MOR146-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location19882417-19888004 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 19883845 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 153 (Y153*)
Ref Sequence ENSEMBL: ENSMUSP00000078603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073765] [ENSMUST00000079660]
Predicted Effect probably null
Transcript: ENSMUST00000073765
AA Change: Y153*
SMART Domains Protein: ENSMUSP00000073437
Gene: ENSMUSG00000063842
AA Change: Y153*

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:7tm_4 31 306 3.1e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 282 1.3e-7 PFAM
Pfam:7tm_1 41 290 5.7e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000079660
AA Change: Y153*
SMART Domains Protein: ENSMUSP00000078603
Gene: ENSMUSG00000063842
AA Change: Y153*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 303 8.3e-8 PFAM
Pfam:7tm_1 41 290 4.5e-22 PFAM
Meta Mutation Damage Score 0.6296 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Olfr862
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Olfr862 APN 9 19883548 nonsense probably null
IGL01636:Olfr862 APN 9 19884188 missense probably benign 0.14
IGL01765:Olfr862 APN 9 19883951 missense possibly damaging 0.71
IGL01967:Olfr862 APN 9 19883589 missense probably damaging 0.97
IGL03145:Olfr862 APN 9 19883439 missense possibly damaging 0.93
IGL03222:Olfr862 APN 9 19884199 nonsense probably null
R0117:Olfr862 UTSW 9 19884299 missense probably damaging 0.96
R0662:Olfr862 UTSW 9 19883952 missense probably benign 0.32
R2399:Olfr862 UTSW 9 19883924 missense probably damaging 0.98
R4224:Olfr862 UTSW 9 19883600 missense probably benign 0.44
R4572:Olfr862 UTSW 9 19883979 missense probably benign
R5607:Olfr862 UTSW 9 19883976 missense probably benign 0.16
R5741:Olfr862 UTSW 9 19883561 missense possibly damaging 0.92
R5759:Olfr862 UTSW 9 19884188 missense probably benign 0.14
R6237:Olfr862 UTSW 9 19884069 missense probably damaging 1.00
R7075:Olfr862 UTSW 9 19884063 missense probably benign 0.16
R7534:Olfr862 UTSW 9 19884176 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CAACTGACAGGTGAGATCCAC -3'
(R):5'- ATGCAGCCTGCCTAACTCAG -3'

Sequencing Primer
(F):5'- CAGGTAGAGAATGCTTTATATTTCCC -3'
(R):5'- AACTCAGGTGTCTTTCTTCACTC -3'
Posted On2018-05-24