Incidental Mutation 'R6434:Ilf3'
ID518703
Institutional Source Beutler Lab
Gene Symbol Ilf3
Ensembl Gene ENSMUSG00000032178
Gene Nameinterleukin enhancer binding factor 3
SynonymsNF90
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6434 (G1)
Quality Score203.009
Status Validated
Chromosome9
Chromosomal Location21367871-21405361 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 21403151 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067646] [ENSMUST00000115414] [ENSMUST00000213518] [ENSMUST00000213603] [ENSMUST00000214758] [ENSMUST00000216892] [ENSMUST00000217348]
Predicted Effect unknown
Transcript: ENSMUST00000067646
AA Change: N693S
SMART Domains Protein: ENSMUSP00000065770
Gene: ENSMUSG00000032178
AA Change: N693S

DomainStartEndE-ValueType
DZF 88 342 3.87e-166 SMART
low complexity region 375 396 N/A INTRINSIC
DSRM 402 466 2.2e-16 SMART
low complexity region 490 508 N/A INTRINSIC
DSRM 525 589 2.73e-21 SMART
low complexity region 638 688 N/A INTRINSIC
low complexity region 691 725 N/A INTRINSIC
low complexity region 745 769 N/A INTRINSIC
low complexity region 777 807 N/A INTRINSIC
low complexity region 810 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115414
SMART Domains Protein: ENSMUSP00000111074
Gene: ENSMUSG00000032178

DomainStartEndE-ValueType
DZF 88 342 3.87e-166 SMART
low complexity region 375 396 N/A INTRINSIC
DSRM 402 466 2.2e-16 SMART
low complexity region 490 508 N/A INTRINSIC
DSRM 525 589 2.73e-21 SMART
low complexity region 638 688 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181812
Predicted Effect unknown
Transcript: ENSMUST00000213518
AA Change: N706S
Predicted Effect unknown
Transcript: ENSMUST00000213603
AA Change: N706S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214217
Predicted Effect unknown
Transcript: ENSMUST00000214758
AA Change: N706S
Predicted Effect probably benign
Transcript: ENSMUST00000215169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215438
Predicted Effect probably benign
Transcript: ENSMUST00000216892
Predicted Effect probably benign
Transcript: ENSMUST00000217348
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: The protein encoded by this gene contains two double-stranded RNA binding domains and functions in the post-transcriptional regulation of gene expression. It is a component of an RNA-protein complex that may be involved in mediating the export of messenger RNAs. Alternative splicing results in multiple transcript variants encoding distinct isoforms. These isoforms are grouped into two categories, NFAR-1 or NFAR-2, based on variation at the C-terminus. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are born small and weak, show tachypnea and multi-organ apoptosis, and die neonatally due to neuromuscular respiratory failure. The diaphragm and other skeletal muscles show disorganization and paucity of myofibers,myocyte degeneration and elevated apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Herc1 T A 9: 66,486,182 H4114Q probably damaging Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Ilf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Ilf3 APN 9 21396051 missense probably damaging 1.00
IGL01013:Ilf3 APN 9 21399691 missense possibly damaging 0.91
IGL01352:Ilf3 APN 9 21392322 missense possibly damaging 0.89
IGL01975:Ilf3 APN 9 21392379 missense probably benign 0.03
IGL02826:Ilf3 APN 9 21398044 missense probably benign 0.20
IGL03238:Ilf3 APN 9 21392350 missense probably damaging 1.00
PIT4466001:Ilf3 UTSW 9 21403366 missense unknown
R0047:Ilf3 UTSW 9 21388714 missense possibly damaging 0.76
R0047:Ilf3 UTSW 9 21388714 missense possibly damaging 0.76
R0090:Ilf3 UTSW 9 21395414 missense probably damaging 1.00
R0355:Ilf3 UTSW 9 21397970 missense probably damaging 1.00
R1768:Ilf3 UTSW 9 21403142 unclassified probably benign
R1889:Ilf3 UTSW 9 21404767 unclassified probably benign
R1895:Ilf3 UTSW 9 21404767 unclassified probably benign
R1918:Ilf3 UTSW 9 21393714 missense probably damaging 1.00
R2930:Ilf3 UTSW 9 21399590 missense possibly damaging 0.91
R3912:Ilf3 UTSW 9 21398126 missense possibly damaging 0.77
R3913:Ilf3 UTSW 9 21398126 missense possibly damaging 0.77
R4080:Ilf3 UTSW 9 21403134 critical splice acceptor site probably null
R4412:Ilf3 UTSW 9 21399560 missense possibly damaging 0.77
R4510:Ilf3 UTSW 9 21399215 missense possibly damaging 0.95
R4511:Ilf3 UTSW 9 21399215 missense possibly damaging 0.95
R5201:Ilf3 UTSW 9 21389383 missense probably damaging 1.00
R5785:Ilf3 UTSW 9 21394872 missense probably damaging 1.00
R6303:Ilf3 UTSW 9 21403136 unclassified probably benign
R6406:Ilf3 UTSW 9 21396244 missense probably damaging 0.99
R7169:Ilf3 UTSW 9 21395426 missense probably damaging 0.96
X0066:Ilf3 UTSW 9 21392406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTCATCAGCTGAGGGTG -3'
(R):5'- TAGCTGCTGTACTGGCTCTG -3'

Sequencing Primer
(F):5'- GCTTAAGCCAGGCTGCCTC -3'
(R):5'- TAAGGTTGCTGCTGGCCC -3'
Posted On2018-05-24