Incidental Mutation 'R6435:Rgs21'
ID518732
Institutional Source Beutler Lab
Gene Symbol Rgs21
Ensembl Gene ENSMUSG00000098509
Gene Nameregulator of G-protein signalling 21
SynonymsEG624910
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6435 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location144516648-144567667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144519827 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 108 (F108L)
Ref Sequence ENSEMBL: ENSMUSP00000139265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184189]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184008
Predicted Effect probably damaging
Transcript: ENSMUST00000184189
AA Change: F108L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139265
Gene: ENSMUSG00000098509
AA Change: F108L

DomainStartEndE-ValueType
RGS 21 137 2.84e-50 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Regulator of G protein signaling (RGS) proteins are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins are GTPase-activating proteins for Gi (see GNAI1; MIM 139310) and Gq (see GNAQ; MIM 600998) class G-alpha proteins. They accelerate transit through the cycle of GTP binding and hydrolysis and thereby accelerate signaling kinetics and termination.[supplied by OMIM, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T C 19: 5,503,418 I112V probably benign Het
Abl1 A T 2: 31,801,549 T1027S possibly damaging Het
Ablim1 T C 19: 57,061,355 I159V possibly damaging Het
Adcy1 A G 11: 7,161,367 N886S possibly damaging Het
Baz1b G A 5: 135,237,945 D1203N probably damaging Het
Chmp2a A T 7: 13,032,774 Y72* probably null Het
Col6a1 A T 10: 76,711,123 I755N unknown Het
Defa24 T A 8: 21,734,674 F46L possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gcn1l1 A T 5: 115,611,022 probably null Het
Gfpt2 A G 11: 49,835,651 S628G probably benign Het
Gm4969 T C 7: 19,100,919 probably benign Het
Hsdl2 C A 4: 59,610,668 Q222K unknown Het
Ighv1-9 T A 12: 114,583,586 I111F probably benign Het
Itch G A 2: 155,209,129 D579N probably benign Het
Jdp2 A T 12: 85,608,358 K65M probably damaging Het
Kif15 A T 9: 122,986,491 E222V probably damaging Het
Map1b A G 13: 99,516,363 V42A probably damaging Het
Mecom T A 3: 29,980,249 E426V probably damaging Het
Mfsd6 G T 1: 52,709,444 Y87* probably null Het
Mybpc2 A G 7: 44,506,057 V924A possibly damaging Het
Naip6 A T 13: 100,294,741 M1196K probably benign Het
Olfr669 A G 7: 104,938,834 M103V probably damaging Het
Pcdh9 G A 14: 93,887,844 P297S probably benign Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Runx1 A T 16: 92,644,295 S209T possibly damaging Het
Sdccag8 G T 1: 176,814,862 probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srgap1 T C 10: 121,800,827 D741G possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tsc1 G A 2: 28,676,452 V627M probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp612 A G 8: 110,089,320 I347M probably damaging Het
Other mutations in Rgs21
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4489:Rgs21 UTSW 1 144519875 missense possibly damaging 0.92
R5666:Rgs21 UTSW 1 144536942 missense probably benign 0.43
R5670:Rgs21 UTSW 1 144536942 missense probably benign 0.43
R6164:Rgs21 UTSW 1 144541297 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTCCCAGAAGATTGTTAAGAACC -3'
(R):5'- GCATGACCTTGCTGCAATTTTC -3'

Sequencing Primer
(F):5'- CCAGAAGATTGTTAAGAACCTGATAC -3'
(R):5'- CTTGCTGCAATTTTCTATCCAATAAC -3'
Posted On2018-05-24