Incidental Mutation 'R6435:Abl1'
ID518735
Institutional Source Beutler Lab
Gene Symbol Abl1
Ensembl Gene ENSMUSG00000026842
Gene Namec-abl oncogene 1, non-receptor tyrosine kinase
Synonymsc-Abl, E430008G22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R6435 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location31688376-31804227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31801549 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1027 (T1027S)
Ref Sequence ENSEMBL: ENSMUSP00000075167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028190] [ENSMUST00000057407] [ENSMUST00000075759] [ENSMUST00000142554]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028190
AA Change: T1008S

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028190
Gene: ENSMUSG00000026842
AA Change: T1008S

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
SH3 64 120 6.95e-16 SMART
SH2 125 208 6.52e-32 SMART
TyrKc 242 493 4.48e-149 SMART
low complexity region 698 703 N/A INTRINSIC
low complexity region 802 810 N/A INTRINSIC
low complexity region 883 907 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 964 983 N/A INTRINSIC
FABD 997 1123 1.36e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057407
SMART Domains Protein: ENSMUSP00000055746
Gene: ENSMUSG00000043102

DomainStartEndE-ValueType
Pfam:RFamide_26RFa 4 124 1.4e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000075759
AA Change: T1027S

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075167
Gene: ENSMUSG00000026842
AA Change: T1027S

DomainStartEndE-ValueType
SH3 83 139 6.95e-16 SMART
SH2 144 227 6.52e-32 SMART
TyrKc 261 512 4.48e-149 SMART
low complexity region 717 722 N/A INTRINSIC
low complexity region 821 829 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
low complexity region 968 979 N/A INTRINSIC
low complexity region 983 1002 N/A INTRINSIC
FABD 1016 1142 1.36e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124726
Predicted Effect probably benign
Transcript: ENSMUST00000142554
SMART Domains Protein: ENSMUSP00000142123
Gene: ENSMUSG00000026842

DomainStartEndE-ValueType
PDB:1OPL|B 1 47 2e-27 PDB
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a protooncogene that encodes a protein tyrosine kinase involved in a variety of cellular processes, including cell division, adhesion, differentiation, and response to stress. The activity of the protein is negatively regulated by its SH3 domain, whereby deletion of the region encoding this domain results in an oncogene. The ubiquitously expressed protein has DNA-binding activity that is regulated by CDC2-mediated phosphorylation, suggesting a cell cycle function. This gene has been found fused to a variety of translocation partner genes in various leukemias, most notably the t(9;22) translocation that results in a fusion with the 5' end of the breakpoint cluster region gene (BCR; MIM:151410). Alternative splicing of this gene results in two transcript variants, which contain alternative first exons that are spliced to the remaining common exons. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have increased perinatal and postnatal mortality and may display foreshortened crania, abnormal development of spleen, head, heart and eye, reduced B and T cell populations, and osteoporosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T C 19: 5,503,418 I112V probably benign Het
Ablim1 T C 19: 57,061,355 I159V possibly damaging Het
Adcy1 A G 11: 7,161,367 N886S possibly damaging Het
Baz1b G A 5: 135,237,945 D1203N probably damaging Het
Chmp2a A T 7: 13,032,774 Y72* probably null Het
Col6a1 A T 10: 76,711,123 I755N unknown Het
Defa24 T A 8: 21,734,674 F46L possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gcn1l1 A T 5: 115,611,022 probably null Het
Gfpt2 A G 11: 49,835,651 S628G probably benign Het
Gm4969 T C 7: 19,100,919 probably benign Het
Hsdl2 C A 4: 59,610,668 Q222K unknown Het
Ighv1-9 T A 12: 114,583,586 I111F probably benign Het
Itch G A 2: 155,209,129 D579N probably benign Het
Jdp2 A T 12: 85,608,358 K65M probably damaging Het
Kif15 A T 9: 122,986,491 E222V probably damaging Het
Map1b A G 13: 99,516,363 V42A probably damaging Het
Mecom T A 3: 29,980,249 E426V probably damaging Het
Mfsd6 G T 1: 52,709,444 Y87* probably null Het
Mybpc2 A G 7: 44,506,057 V924A possibly damaging Het
Naip6 A T 13: 100,294,741 M1196K probably benign Het
Olfr669 A G 7: 104,938,834 M103V probably damaging Het
Pcdh9 G A 14: 93,887,844 P297S probably benign Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Rgs21 A G 1: 144,519,827 F108L probably damaging Het
Runx1 A T 16: 92,644,295 S209T possibly damaging Het
Sdccag8 G T 1: 176,814,862 probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srgap1 T C 10: 121,800,827 D741G possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tsc1 G A 2: 28,676,452 V627M probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp612 A G 8: 110,089,320 I347M probably damaging Het
Other mutations in Abl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Abl1 APN 2 31790812 missense probably damaging 1.00
IGL01453:Abl1 APN 2 31778977 missense probably damaging 0.99
IGL02079:Abl1 APN 2 31689948 splice site probably benign
IGL02179:Abl1 APN 2 31792249 missense probably damaging 1.00
IGL02424:Abl1 APN 2 31801132 missense probably benign
IGL02824:Abl1 APN 2 31800819 missense probably damaging 1.00
Hourglass UTSW 2 31794574 missense probably damaging 1.00
Sands UTSW 2 31779010 missense probably damaging 1.00
R0733:Abl1 UTSW 2 31778945 missense probably damaging 1.00
R1222:Abl1 UTSW 2 31800994 missense probably benign
R1428:Abl1 UTSW 2 31801810 missense probably damaging 0.99
R1582:Abl1 UTSW 2 31800359 missense probably damaging 1.00
R1596:Abl1 UTSW 2 31790338 missense probably damaging 0.99
R1824:Abl1 UTSW 2 31800644 missense probably benign 0.01
R2240:Abl1 UTSW 2 31800505 missense probably benign 0.17
R2251:Abl1 UTSW 2 31779119 missense probably damaging 1.00
R2405:Abl1 UTSW 2 31800974 missense possibly damaging 0.50
R2893:Abl1 UTSW 2 31797612 missense probably benign 0.22
R3952:Abl1 UTSW 2 31784537 missense probably damaging 1.00
R4119:Abl1 UTSW 2 31801727 missense probably damaging 1.00
R4210:Abl1 UTSW 2 31801696 missense probably damaging 0.98
R4809:Abl1 UTSW 2 31800242 missense probably damaging 1.00
R4854:Abl1 UTSW 2 31779010 missense probably damaging 1.00
R5345:Abl1 UTSW 2 31797047 missense probably damaging 0.97
R5518:Abl1 UTSW 2 31790742 missense probably damaging 1.00
R5551:Abl1 UTSW 2 31801670 missense probably benign 0.03
R5568:Abl1 UTSW 2 31779074 missense probably damaging 1.00
R5627:Abl1 UTSW 2 31800583 missense probably benign 0.00
R6492:Abl1 UTSW 2 31801655 missense probably benign 0.38
R6738:Abl1 UTSW 2 31794574 missense probably damaging 1.00
R7310:Abl1 UTSW 2 31800592 missense possibly damaging 0.93
R7398:Abl1 UTSW 2 31790799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTGAGAAAGCCTGTGC -3'
(R):5'- CTTGTTGATAGCCTCACGGAAGG -3'

Sequencing Primer
(F):5'- AAAGCCTGTGCCCCCATCTG -3'
(R):5'- GGAAGGCAAACTTGTTCCTCATCTG -3'
Posted On2018-05-24