Incidental Mutation 'R6435:Zfp612'
ID518748
Institutional Source Beutler Lab
Gene Symbol Zfp612
Ensembl Gene ENSMUSG00000044676
Gene Namezinc finger protein 612
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6435 (G1)
Quality Score216.009
Status Validated
Chromosome8
Chromosomal Location110079746-110092741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110089320 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 347 (I347M)
Ref Sequence ENSEMBL: ENSMUSP00000062474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058804] [ENSMUST00000165700] [ENSMUST00000212754]
Predicted Effect probably damaging
Transcript: ENSMUST00000058804
AA Change: I347M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062474
Gene: ENSMUSG00000044676
AA Change: I347M

DomainStartEndE-ValueType
KRAB 11 71 2e-32 SMART
low complexity region 135 146 N/A INTRINSIC
ZnF_C2H2 225 247 1.45e-2 SMART
ZnF_C2H2 253 275 2.67e-1 SMART
ZnF_C2H2 281 303 1.4e-4 SMART
ZnF_C2H2 309 331 2.91e-2 SMART
ZnF_C2H2 337 359 3.16e-3 SMART
ZnF_C2H2 365 387 4.17e-3 SMART
ZnF_C2H2 393 415 1.82e-3 SMART
ZnF_C2H2 421 443 3.69e-4 SMART
ZnF_C2H2 449 471 3.69e-4 SMART
ZnF_C2H2 477 499 1.58e-3 SMART
ZnF_C2H2 505 527 4.87e-4 SMART
ZnF_C2H2 533 555 1.38e-3 SMART
ZnF_C2H2 561 583 5.06e-2 SMART
ZnF_C2H2 589 611 5.9e-3 SMART
ZnF_C2H2 617 639 9.44e-2 SMART
ZnF_C2H2 645 667 1.03e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165700
Predicted Effect probably damaging
Transcript: ENSMUST00000212754
AA Change: I386M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T C 19: 5,503,418 I112V probably benign Het
Abl1 A T 2: 31,801,549 T1027S possibly damaging Het
Ablim1 T C 19: 57,061,355 I159V possibly damaging Het
Adcy1 A G 11: 7,161,367 N886S possibly damaging Het
Baz1b G A 5: 135,237,945 D1203N probably damaging Het
Chmp2a A T 7: 13,032,774 Y72* probably null Het
Col6a1 A T 10: 76,711,123 I755N unknown Het
Defa24 T A 8: 21,734,674 F46L possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gcn1l1 A T 5: 115,611,022 probably null Het
Gfpt2 A G 11: 49,835,651 S628G probably benign Het
Gm4969 T C 7: 19,100,919 probably benign Het
Hsdl2 C A 4: 59,610,668 Q222K unknown Het
Ighv1-9 T A 12: 114,583,586 I111F probably benign Het
Itch G A 2: 155,209,129 D579N probably benign Het
Jdp2 A T 12: 85,608,358 K65M probably damaging Het
Kif15 A T 9: 122,986,491 E222V probably damaging Het
Map1b A G 13: 99,516,363 V42A probably damaging Het
Mecom T A 3: 29,980,249 E426V probably damaging Het
Mfsd6 G T 1: 52,709,444 Y87* probably null Het
Mybpc2 A G 7: 44,506,057 V924A possibly damaging Het
Naip6 A T 13: 100,294,741 M1196K probably benign Het
Olfr669 A G 7: 104,938,834 M103V probably damaging Het
Pcdh9 G A 14: 93,887,844 P297S probably benign Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Rgs21 A G 1: 144,519,827 F108L probably damaging Het
Runx1 A T 16: 92,644,295 S209T possibly damaging Het
Sdccag8 G T 1: 176,814,862 probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srgap1 T C 10: 121,800,827 D741G possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tsc1 G A 2: 28,676,452 V627M probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Other mutations in Zfp612
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Zfp612 UTSW 8 110090038 missense probably damaging 1.00
R1920:Zfp612 UTSW 8 110088463 missense probably benign 0.03
R2994:Zfp612 UTSW 8 110089417 missense probably damaging 1.00
R4281:Zfp612 UTSW 8 110090059 missense probably damaging 0.98
R4378:Zfp612 UTSW 8 110089051 missense possibly damaging 0.92
R4492:Zfp612 UTSW 8 110089297 missense probably damaging 0.99
R4748:Zfp612 UTSW 8 110088672 missense probably benign 0.37
R4890:Zfp612 UTSW 8 110089944 nonsense probably null
R5200:Zfp612 UTSW 8 110089900 nonsense probably null
R5443:Zfp612 UTSW 8 110089595 missense possibly damaging 0.85
R5864:Zfp612 UTSW 8 110089726 missense probably damaging 1.00
R6177:Zfp612 UTSW 8 110089974 missense probably damaging 1.00
R6601:Zfp612 UTSW 8 110089549 missense possibly damaging 0.92
R7082:Zfp612 UTSW 8 110089705 missense probably damaging 1.00
R7083:Zfp612 UTSW 8 110089136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGTGTAAGGTATGCGGCA -3'
(R):5'- CACTGCACTTATATGGCTTCTCC -3'

Sequencing Primer
(F):5'- CAAGGCCTTCAGTGTTAATGGAAGTC -3'
(R):5'- ATTCTCAGATGCTGCCGAAG -3'
Posted On2018-05-24