Incidental Mutation 'R6435:1700020D05Rik'
ID518762
Institutional Source Beutler Lab
Gene Symbol 1700020D05Rik
Ensembl Gene ENSMUSG00000100937
Gene NameRIKEN cDNA 1700020D05 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6435 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5502767-5503787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5503418 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 112 (I112V)
Ref Sequence ENSEMBL: ENSMUSP00000140922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070172] [ENSMUST00000189704]
Predicted Effect probably benign
Transcript: ENSMUST00000070172
SMART Domains Protein: ENSMUSP00000070915
Gene: ENSMUSG00000056185

DomainStartEndE-ValueType
Pfam:PX 24 165 1.4e-19 PFAM
Pfam:Vps5 183 394 9.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189704
AA Change: I112V

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140922
Gene: ENSMUSG00000100937
AA Change: I112V

DomainStartEndE-ValueType
Pfam:MAGE 82 253 2.2e-57 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 A T 2: 31,801,549 T1027S possibly damaging Het
Ablim1 T C 19: 57,061,355 I159V possibly damaging Het
Adcy1 A G 11: 7,161,367 N886S possibly damaging Het
Baz1b G A 5: 135,237,945 D1203N probably damaging Het
Chmp2a A T 7: 13,032,774 Y72* probably null Het
Col6a1 A T 10: 76,711,123 I755N unknown Het
Defa24 T A 8: 21,734,674 F46L possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gcn1l1 A T 5: 115,611,022 probably null Het
Gfpt2 A G 11: 49,835,651 S628G probably benign Het
Gm4969 T C 7: 19,100,919 probably benign Het
Hsdl2 C A 4: 59,610,668 Q222K unknown Het
Ighv1-9 T A 12: 114,583,586 I111F probably benign Het
Itch G A 2: 155,209,129 D579N probably benign Het
Jdp2 A T 12: 85,608,358 K65M probably damaging Het
Kif15 A T 9: 122,986,491 E222V probably damaging Het
Map1b A G 13: 99,516,363 V42A probably damaging Het
Mecom T A 3: 29,980,249 E426V probably damaging Het
Mfsd6 G T 1: 52,709,444 Y87* probably null Het
Mybpc2 A G 7: 44,506,057 V924A possibly damaging Het
Naip6 A T 13: 100,294,741 M1196K probably benign Het
Olfr669 A G 7: 104,938,834 M103V probably damaging Het
Pcdh9 G A 14: 93,887,844 P297S probably benign Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Rgs21 A G 1: 144,519,827 F108L probably damaging Het
Runx1 A T 16: 92,644,295 S209T possibly damaging Het
Sdccag8 G T 1: 176,814,862 probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srgap1 T C 10: 121,800,827 D741G possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tsc1 G A 2: 28,676,452 V627M probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp612 A G 8: 110,089,320 I347M probably damaging Het
Other mutations in 1700020D05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:1700020D05Rik APN 19 5503181 missense possibly damaging 0.46
IGL03285:1700020D05Rik APN 19 5503177 missense probably damaging 1.00
R4445:1700020D05Rik UTSW 19 5502994 missense probably damaging 1.00
R4804:1700020D05Rik UTSW 19 5503000 missense possibly damaging 0.82
R5449:1700020D05Rik UTSW 19 5503264 missense probably benign 0.44
R5542:1700020D05Rik UTSW 19 5503435 missense probably damaging 0.99
R6476:1700020D05Rik UTSW 19 5503225 missense probably damaging 1.00
R6764:1700020D05Rik UTSW 19 5502872 missense probably damaging 1.00
R7102:1700020D05Rik UTSW 19 5503595 missense probably benign 0.00
R7232:1700020D05Rik UTSW 19 5503631 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACCAGACATCGTTTTCTGGG -3'
(R):5'- AAGCTTTCGTCAGGTCCAG -3'

Sequencing Primer
(F):5'- GTGGCCATTCATTAAGATGAGCCC -3'
(R):5'- TTTCGTCAGGTCCAGGCCAC -3'
Posted On2018-05-24