Incidental Mutation 'R6435:Ablim1'
ID518763
Institutional Source Beutler Lab
Gene Symbol Ablim1
Ensembl Gene ENSMUSG00000025085
Gene Nameactin-binding LIM protein 1
Synonyms2210411C18Rik, abLIM-L, abLIM-M, 4833406P10Rik, abLIM-S, 9330196J19Rik, 2610209L21Rik, Limab1
Accession Numbers

Genbank: NM_178688; MGI: 1194500

Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R6435 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location57032733-57314919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57061355 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 159 (I159V)
Ref Sequence ENSEMBL: ENSMUSP00000107153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079360] [ENSMUST00000099294] [ENSMUST00000104902] [ENSMUST00000111526] [ENSMUST00000111528] [ENSMUST00000111529] [ENSMUST00000111544] [ENSMUST00000111546] [ENSMUST00000111550] [ENSMUST00000111555] [ENSMUST00000111558] [ENSMUST00000111559]
Predicted Effect probably benign
Transcript: ENSMUST00000079360
AA Change: I491V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000078336
Gene: ENSMUSG00000025085
AA Change: I491V

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
Pfam:AbLIM_anchor 393 825 1.9e-139 PFAM
VHP 826 861 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099294
AA Change: I371V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096897
Gene: ENSMUSG00000025085
AA Change: I371V

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 467 491 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
VHP 619 654 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000104902
AA Change: I175V

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000127818
Gene: ENSMUSG00000025085
AA Change: I175V

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 1e-8 PDB
low complexity region 88 97 N/A INTRINSIC
low complexity region 219 235 N/A INTRINSIC
coiled coil region 358 382 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
VHP 510 545 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111526
AA Change: I105V

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107151
Gene: ENSMUSG00000025085
AA Change: I105V

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
PDB:1WIG|A 1 28 6e-9 PDB
coiled coil region 213 237 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
VHP 365 400 1.22e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111528
AA Change: I159V

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107153
Gene: ENSMUSG00000025085
AA Change: I159V

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 72 81 N/A INTRINSIC
coiled coil region 267 291 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
VHP 419 454 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111529
AA Change: I131V

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107154
Gene: ENSMUSG00000025085
AA Change: I131V

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 44 53 N/A INTRINSIC
coiled coil region 239 263 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
VHP 391 426 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111544
AA Change: I371V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107169
Gene: ENSMUSG00000025085
AA Change: I371V

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
low complexity region 422 427 N/A INTRINSIC
coiled coil region 481 505 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
VHP 633 668 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111546
AA Change: I371V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107172
Gene: ENSMUSG00000025085
AA Change: I371V

DomainStartEndE-ValueType
LIM 22 73 5.7e-12 SMART
LIM 81 133 6.6e-15 SMART
LIM 149 200 5.4e-20 SMART
LIM 208 260 2.8e-14 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 514 538 N/A INTRINSIC
low complexity region 563 578 N/A INTRINSIC
VHP 666 700 1.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111550
AA Change: I399V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107175
Gene: ENSMUSG00000025085
AA Change: I399V

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 312 321 N/A INTRINSIC
coiled coil region 495 519 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
VHP 647 682 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111555
AA Change: I447V

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107180
Gene: ENSMUSG00000025085
AA Change: I447V

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
low complexity region 360 369 N/A INTRINSIC
coiled coil region 590 614 N/A INTRINSIC
low complexity region 639 654 N/A INTRINSIC
VHP 742 777 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111558
AA Change: I412V

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107183
Gene: ENSMUSG00000025085
AA Change: I412V

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 325 334 N/A INTRINSIC
low complexity region 498 503 N/A INTRINSIC
coiled coil region 557 581 N/A INTRINSIC
low complexity region 606 621 N/A INTRINSIC
VHP 709 744 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111559
AA Change: I384V

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107184
Gene: ENSMUSG00000025085
AA Change: I384V

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 297 306 N/A INTRINSIC
coiled coil region 527 551 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
VHP 679 714 1.22e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156316
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the retina-specific isoform are healthy, fertile, and show no defects in retinal development or retinofugal projections. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T C 19: 5,503,418 I112V probably benign Het
Abl1 A T 2: 31,801,549 T1027S possibly damaging Het
Adcy1 A G 11: 7,161,367 N886S possibly damaging Het
Baz1b G A 5: 135,237,945 D1203N probably damaging Het
Chmp2a A T 7: 13,032,774 Y72* probably null Het
Col6a1 A T 10: 76,711,123 I755N unknown Het
Defa24 T A 8: 21,734,674 F46L possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gcn1l1 A T 5: 115,611,022 probably null Het
Gfpt2 A G 11: 49,835,651 S628G probably benign Het
Gm4969 T C 7: 19,100,919 probably benign Het
Hsdl2 C A 4: 59,610,668 Q222K unknown Het
Ighv1-9 T A 12: 114,583,586 I111F probably benign Het
Itch G A 2: 155,209,129 D579N probably benign Het
Jdp2 A T 12: 85,608,358 K65M probably damaging Het
Kif15 A T 9: 122,986,491 E222V probably damaging Het
Map1b A G 13: 99,516,363 V42A probably damaging Het
Mecom T A 3: 29,980,249 E426V probably damaging Het
Mfsd6 G T 1: 52,709,444 Y87* probably null Het
Mybpc2 A G 7: 44,506,057 V924A possibly damaging Het
Naip6 A T 13: 100,294,741 M1196K probably benign Het
Olfr669 A G 7: 104,938,834 M103V probably damaging Het
Pcdh9 G A 14: 93,887,844 P297S probably benign Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Rgs21 A G 1: 144,519,827 F108L probably damaging Het
Runx1 A T 16: 92,644,295 S209T possibly damaging Het
Sdccag8 G T 1: 176,814,862 probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srgap1 T C 10: 121,800,827 D741G possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tsc1 G A 2: 28,676,452 V627M probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp612 A G 8: 110,089,320 I347M probably damaging Het
Other mutations in Ablim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00466:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00478:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00847:Ablim1 APN 19 57152290 missense possibly damaging 0.59
IGL01063:Ablim1 APN 19 57061328 missense probably damaging 1.00
IGL01304:Ablim1 APN 19 57215721 missense probably benign
IGL01385:Ablim1 APN 19 57068914 missense probably damaging 1.00
IGL01707:Ablim1 APN 19 57039447 missense probably damaging 1.00
IGL02386:Ablim1 APN 19 57134654 missense probably damaging 1.00
IGL02427:Ablim1 APN 19 57079880 splice site probably benign
IGL02498:Ablim1 APN 19 57152319 nonsense probably null
A9681:Ablim1 UTSW 19 57173323 critical splice donor site probably null
R0089:Ablim1 UTSW 19 57043031 missense probably damaging 1.00
R0226:Ablim1 UTSW 19 57043870 missense probably damaging 1.00
R1419:Ablim1 UTSW 19 57134633 missense probably damaging 1.00
R1473:Ablim1 UTSW 19 57068236 missense probably damaging 1.00
R1587:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1588:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1935:Ablim1 UTSW 19 57215965 start gained probably null
R1936:Ablim1 UTSW 19 57215965 start gained probably null
R2021:Ablim1 UTSW 19 57047018 missense probably damaging 0.98
R2110:Ablim1 UTSW 19 57043813 missense possibly damaging 0.83
R2270:Ablim1 UTSW 19 57077431 missense possibly damaging 0.58
R2509:Ablim1 UTSW 19 57152359 missense probably damaging 1.00
R3621:Ablim1 UTSW 19 57152303 missense probably damaging 0.97
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3733:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3734:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3878:Ablim1 UTSW 19 57037210 utr 3 prime probably null
R4354:Ablim1 UTSW 19 57155278 missense probably damaging 1.00
R4543:Ablim1 UTSW 19 57077442 missense possibly damaging 0.87
R4749:Ablim1 UTSW 19 57215721 missense probably benign
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R5072:Ablim1 UTSW 19 57073853 critical splice donor site probably null
R5277:Ablim1 UTSW 19 57155261 missense probably damaging 1.00
R5331:Ablim1 UTSW 19 57155249 missense probably damaging 1.00
R5354:Ablim1 UTSW 19 57130923 missense probably benign 0.07
R5893:Ablim1 UTSW 19 57215853 missense probably benign 0.07
R5958:Ablim1 UTSW 19 57041935 missense probably damaging 1.00
R6460:Ablim1 UTSW 19 57079839 missense possibly damaging 0.96
R6642:Ablim1 UTSW 19 57130852 missense probably benign 0.03
R6662:Ablim1 UTSW 19 57073853 critical splice donor site probably null
R6705:Ablim1 UTSW 19 57215821 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCAGGGTTTTCAATATTCTGCC -3'
(R):5'- ATTGGCCATGGAGTATTCATGCG -3'

Sequencing Primer
(F):5'- CAGGGTTTTCAATATTCTGCCAGTGG -3'
(R):5'- CATGCGCATGAATACTTATTGATTG -3'
Posted On2018-05-24