Incidental Mutation 'R6436:Fnbp1'
ID518767
Institutional Source Beutler Lab
Gene Symbol Fnbp1
Ensembl Gene ENSMUSG00000075415
Gene Nameformin binding protein 1
Synonyms2210010H06Rik, FBP17, FBP1, 1110057E06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.483) question?
Stock #R6436 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location31026206-31142008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31096127 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 3 (D3G)
Ref Sequence ENSEMBL: ENSMUSP00000109189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073879] [ENSMUST00000075326] [ENSMUST00000100207] [ENSMUST00000100208] [ENSMUST00000113552] [ENSMUST00000113555] [ENSMUST00000113559] [ENSMUST00000113560] [ENSMUST00000113562] [ENSMUST00000113564] [ENSMUST00000136181] [ENSMUST00000149196]
Predicted Effect probably damaging
Transcript: ENSMUST00000073879
AA Change: D82G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109188
Gene: ENSMUSG00000075415
AA Change: D82G

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 471 480 N/A INTRINSIC
SH3 486 543 3.2e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000075326
AA Change: D82G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074796
Gene: ENSMUSG00000075415
AA Change: D82G

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 360 451 1e-26 PDB
low complexity region 503 512 N/A INTRINSIC
SH3 518 575 3.2e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100207
AA Change: D82G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097781
Gene: ENSMUSG00000075415
AA Change: D82G

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 338 424 1e-26 PDB
low complexity region 476 485 N/A INTRINSIC
SH3 491 548 3.2e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100208
AA Change: D82G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097782
Gene: ENSMUSG00000075415
AA Change: D82G

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
PDB:2KE4|A 394 480 2e-26 PDB
low complexity region 532 541 N/A INTRINSIC
SH3 547 604 3.2e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113552
AA Change: D82G

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109181
Gene: ENSMUSG00000075415
AA Change: D82G

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113555
AA Change: D82G

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109184
Gene: ENSMUSG00000075415
AA Change: D82G

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 370 456 1e-26 PDB
low complexity region 508 517 N/A INTRINSIC
SH3 523 580 3.2e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113559
AA Change: D3G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109189
Gene: ENSMUSG00000075415
AA Change: D3G

DomainStartEndE-ValueType
PDB:2EFL|A 1 221 1e-144 PDB
low complexity region 250 262 N/A INTRINSIC
PDB:2KE4|A 300 391 1e-26 PDB
low complexity region 443 452 N/A INTRINSIC
SH3 458 515 3.2e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113560
AA Change: D82G

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109190
Gene: ENSMUSG00000075415
AA Change: D82G

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
PDB:2KE4|A 399 485 2e-26 PDB
low complexity region 537 546 N/A INTRINSIC
SH3 552 609 3.2e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113562
AA Change: D82G

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109192
Gene: ENSMUSG00000075415
AA Change: D82G

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 471 480 N/A INTRINSIC
SH3 486 543 3.2e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113564
AA Change: D82G

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109194
Gene: ENSMUSG00000075415
AA Change: D82G

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 472 481 N/A INTRINSIC
SH3 487 544 3.2e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000128500
AA Change: D72G
SMART Domains Protein: ENSMUSP00000115013
Gene: ENSMUSG00000075415
AA Change: D72G

DomainStartEndE-ValueType
Pfam:FCH 1 80 7.7e-20 PFAM
PDB:2KE4|A 167 253 2e-27 PDB
low complexity region 305 314 N/A INTRINSIC
SH3 320 377 3.2e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136085
Predicted Effect probably damaging
Transcript: ENSMUST00000136181
AA Change: D82G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120580
Gene: ENSMUSG00000075415
AA Change: D82G

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 116 125 N/A INTRINSIC
PDB:2EFL|A 126 160 1e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138581
Predicted Effect probably damaging
Transcript: ENSMUST00000149196
AA Change: D95G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121282
Gene: ENSMUSG00000075415
AA Change: D95G

DomainStartEndE-ValueType
FCH 14 107 8.88e-17 SMART
low complexity region 185 194 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the formin-binding-protein family. The protein contains an N-terminal Fer/Cdc42-interacting protein 4 (CIP4) homology (FCH) domain followed by a coiled-coil domain, a proline-rich motif, a second coiled-coil domain, a Rho family protein-binding domain (RBD), and a C-terminal SH3 domain. This protein binds sorting nexin 2 (SNX2), tankyrase (TNKS), and dynamin; an interaction between this protein and formin has not been demonstrated yet in human. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc C A 15: 74,672,249 V42L possibly damaging Het
Clip1 C T 5: 123,641,785 E433K probably damaging Het
Cmya5 T C 13: 93,089,215 T3122A probably damaging Het
Ctf2 G T 7: 127,719,431 A92E probably damaging Het
Ctsw G T 19: 5,466,294 R184S possibly damaging Het
D130043K22Rik A G 13: 24,877,935 E629G probably damaging Het
Dmbt1 T C 7: 131,116,641 V1523A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fanci T C 7: 79,440,698 I982T probably benign Het
Gm10770 G A 2: 150,178,910 T229I probably benign Het
Gm35315 G A 5: 110,078,712 T287I probably benign Het
Itgb3 T A 11: 104,633,492 D151E probably damaging Het
Lcn8 A T 2: 25,654,978 probably null Het
Ninl A G 2: 150,966,178 L310P probably damaging Het
Nop2 A G 6: 125,137,311 D215G probably benign Het
Olfr1426 T C 19: 12,087,935 T286A probably benign Het
Olfr788 A G 10: 129,472,904 T71A probably damaging Het
Parg T C 14: 32,271,677 W289R probably damaging Het
Pdcd4 A G 19: 53,926,931 probably null Het
Plk2 G T 13: 110,396,036 E95* probably null Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Ptprc T C 1: 138,083,639 D560G possibly damaging Het
Rasal3 T C 17: 32,397,504 Y290C probably damaging Het
Rcsd1 T A 1: 165,657,615 S90C probably damaging Het
Rttn T C 18: 89,110,729 L1935P probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tmc3 T C 7: 83,598,487 Y230H probably damaging Het
Tnfrsf25 A T 4: 152,119,627 probably null Het
Ubl7 T C 9: 57,920,510 L160P probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp646 T A 7: 127,879,941 V430E probably benign Het
Other mutations in Fnbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Fnbp1 APN 2 31083042 missense probably damaging 1.00
IGL01640:Fnbp1 APN 2 31105291 missense probably damaging 1.00
R0381:Fnbp1 UTSW 2 31033029 missense probably benign 0.02
R0573:Fnbp1 UTSW 2 31058978 missense probably damaging 1.00
R0713:Fnbp1 UTSW 2 31036594 missense probably damaging 0.97
R1120:Fnbp1 UTSW 2 31036594 missense probably damaging 0.97
R1364:Fnbp1 UTSW 2 31059031 splice site probably benign
R1974:Fnbp1 UTSW 2 31053047 missense probably null 0.94
R3800:Fnbp1 UTSW 2 31033131 missense probably damaging 1.00
R4176:Fnbp1 UTSW 2 31036119 splice site probably null
R4293:Fnbp1 UTSW 2 31105350 missense probably damaging 1.00
R4478:Fnbp1 UTSW 2 31105254 missense probably damaging 1.00
R4602:Fnbp1 UTSW 2 31036540 critical splice donor site probably null
R4716:Fnbp1 UTSW 2 31055520 missense probably benign 0.03
R5909:Fnbp1 UTSW 2 31048199 splice site probably null
R7075:Fnbp1 UTSW 2 31058914 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGCCTGGATCTAATTTTGTTTG -3'
(R):5'- TTGTGTAATGAACCGGCAAGAT -3'

Sequencing Primer
(F):5'- TCACTATGCAGCCTTGAAGG -3'
(R):5'- TGTAATGAACCGGCAAGATCCTCTG -3'
Posted On2018-05-24