Incidental Mutation 'R6436:Smc1b'
ID518788
Institutional Source Beutler Lab
Gene Symbol Smc1b
Ensembl Gene ENSMUSG00000022432
Gene Namestructural maintenance of chromosomes 1B
SynonymsSMC1beta, Smc1l2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R6436 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location85064689-85131964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85092031 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 825 (R825Q)
Ref Sequence ENSEMBL: ENSMUSP00000023068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023068] [ENSMUST00000227591]
Predicted Effect probably benign
Transcript: ENSMUST00000023068
AA Change: R825Q

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: R825Q

DomainStartEndE-ValueType
Pfam:AAA_23 7 361 2e-10 PFAM
Pfam:AAA_21 27 372 7.2e-9 PFAM
low complexity region 422 437 N/A INTRINSIC
SMC_hinge 513 629 1.5e-23 SMART
PDB:1W1W|D 1046 1218 3e-42 PDB
Blast:AAA 1063 1217 5e-25 BLAST
SCOP:d1e69a_ 1114 1202 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227591
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc C A 15: 74,672,249 V42L possibly damaging Het
Clip1 C T 5: 123,641,785 E433K probably damaging Het
Cmya5 T C 13: 93,089,215 T3122A probably damaging Het
Ctf2 G T 7: 127,719,431 A92E probably damaging Het
Ctsw G T 19: 5,466,294 R184S possibly damaging Het
D130043K22Rik A G 13: 24,877,935 E629G probably damaging Het
Dmbt1 T C 7: 131,116,641 V1523A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fanci T C 7: 79,440,698 I982T probably benign Het
Fnbp1 T C 2: 31,096,127 D3G probably damaging Het
Gm10770 G A 2: 150,178,910 T229I probably benign Het
Gm35315 G A 5: 110,078,712 T287I probably benign Het
Itgb3 T A 11: 104,633,492 D151E probably damaging Het
Lcn8 A T 2: 25,654,978 probably null Het
Ninl A G 2: 150,966,178 L310P probably damaging Het
Nop2 A G 6: 125,137,311 D215G probably benign Het
Olfr1426 T C 19: 12,087,935 T286A probably benign Het
Olfr788 A G 10: 129,472,904 T71A probably damaging Het
Parg T C 14: 32,271,677 W289R probably damaging Het
Pdcd4 A G 19: 53,926,931 probably null Het
Plk2 G T 13: 110,396,036 E95* probably null Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Ptprc T C 1: 138,083,639 D560G possibly damaging Het
Rasal3 T C 17: 32,397,504 Y290C probably damaging Het
Rcsd1 T A 1: 165,657,615 S90C probably damaging Het
Rttn T C 18: 89,110,729 L1935P probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tmc3 T C 7: 83,598,487 Y230H probably damaging Het
Tnfrsf25 A T 4: 152,119,627 probably null Het
Ubl7 T C 9: 57,920,510 L160P probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp646 T A 7: 127,879,941 V430E probably benign Het
Other mutations in Smc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Smc1b APN 15 85129700 missense possibly damaging 0.95
IGL01293:Smc1b APN 15 85131898 missense probably damaging 1.00
IGL01656:Smc1b APN 15 85114776 missense probably damaging 0.99
IGL01807:Smc1b APN 15 85096745 missense probably damaging 0.97
IGL02094:Smc1b APN 15 85097891 splice site probably benign
IGL02121:Smc1b APN 15 85097985 missense probably benign
IGL02631:Smc1b APN 15 85107003 missense probably damaging 0.98
IGL02678:Smc1b APN 15 85065000 nonsense probably null
IGL03197:Smc1b APN 15 85070863 missense possibly damaging 0.85
IGL03214:Smc1b APN 15 85097946 nonsense probably null
IGL03218:Smc1b APN 15 85089713 missense probably benign 0.07
IGL03232:Smc1b APN 15 85129720 missense possibly damaging 0.68
E0370:Smc1b UTSW 15 85127581 missense probably damaging 1.00
PIT4812001:Smc1b UTSW 15 85069651 missense possibly damaging 0.91
R0092:Smc1b UTSW 15 85067724 unclassified probably benign
R0106:Smc1b UTSW 15 85070819 missense probably damaging 1.00
R0106:Smc1b UTSW 15 85070819 missense probably damaging 1.00
R0207:Smc1b UTSW 15 85123759 missense probably benign
R0390:Smc1b UTSW 15 85066277 missense probably damaging 1.00
R0440:Smc1b UTSW 15 85112673 splice site probably benign
R0685:Smc1b UTSW 15 85070820 missense possibly damaging 0.92
R1109:Smc1b UTSW 15 85112815 missense probably damaging 0.98
R1392:Smc1b UTSW 15 85107070 splice site probably benign
R1509:Smc1b UTSW 15 85086134 missense probably benign
R1804:Smc1b UTSW 15 85127790 missense possibly damaging 0.90
R1879:Smc1b UTSW 15 85092067 missense probably benign 0.01
R2086:Smc1b UTSW 15 85121851 splice site probably benign
R2143:Smc1b UTSW 15 85123802 missense probably benign
R2158:Smc1b UTSW 15 85121851 splice site probably benign
R2174:Smc1b UTSW 15 85121851 splice site probably benign
R2471:Smc1b UTSW 15 85092017 missense probably damaging 0.98
R3689:Smc1b UTSW 15 85117263 intron probably benign
R3690:Smc1b UTSW 15 85117263 intron probably benign
R4178:Smc1b UTSW 15 85120647 missense possibly damaging 0.94
R4420:Smc1b UTSW 15 85112830 missense probably damaging 1.00
R4905:Smc1b UTSW 15 85066227 missense probably damaging 1.00
R4919:Smc1b UTSW 15 85117104 intron probably benign
R5114:Smc1b UTSW 15 85064984 missense probably damaging 1.00
R5314:Smc1b UTSW 15 85070865 missense probably benign 0.00
R5476:Smc1b UTSW 15 85086151 missense probably damaging 0.97
R5593:Smc1b UTSW 15 85121641 missense probably benign 0.06
R5690:Smc1b UTSW 15 85112773 missense probably damaging 1.00
R5719:Smc1b UTSW 15 85096658 missense probably benign
R5817:Smc1b UTSW 15 85067783 missense probably damaging 0.99
R5834:Smc1b UTSW 15 85089665 missense probably damaging 1.00
R5930:Smc1b UTSW 15 85086121 missense probably damaging 1.00
R6032:Smc1b UTSW 15 85066229 missense possibly damaging 0.92
R6032:Smc1b UTSW 15 85066229 missense possibly damaging 0.92
R6049:Smc1b UTSW 15 85121695 missense probably damaging 1.00
R6306:Smc1b UTSW 15 85127623 missense probably benign 0.30
R6392:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6426:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6435:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6437:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6508:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6512:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6703:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6737:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6775:Smc1b UTSW 15 85089680 missense probably damaging 0.96
R6889:Smc1b UTSW 15 85067759 missense probably damaging 1.00
R6908:Smc1b UTSW 15 85107010 missense probably damaging 1.00
R7124:Smc1b UTSW 15 85071597 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGATCACAATAAGGCACCATTGG -3'
(R):5'- GGCAATGGCAGTGATTATATTAAGG -3'

Sequencing Primer
(F):5'- GGCACTTCAGCTACTGAT -3'
(R):5'- CAGAGAACACTTACTGCTCTTGGAG -3'
Posted On2018-05-24