Incidental Mutation 'R6437:Vmn2r37'
ID518811
Institutional Source Beutler Lab
Gene Symbol Vmn2r37
Ensembl Gene ENSMUSG00000066828
Gene Namevomeronasal 2, receptor 37
SynonymsV2r14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6437 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location9205546-9223653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 9217851 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 338 (Q338K)
Ref Sequence ENSEMBL: ENSMUSP00000072566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072787]
Predicted Effect probably damaging
Transcript: ENSMUST00000072787
AA Change: Q338K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072566
Gene: ENSMUSG00000066828
AA Change: Q338K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 157 469 2.9e-26 PFAM
Pfam:NCD3G 512 563 1.1e-16 PFAM
Pfam:7tm_3 550 783 1.7e-53 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn C T 4: 156,176,778 V514I probably damaging Het
Atg16l1 T C 1: 87,790,648 L545P probably damaging Het
Ces3b T A 8: 105,092,606 D431E probably damaging Het
Cracr2a A G 6: 127,631,831 D291G probably damaging Het
Csmd2 T G 4: 127,988,100 C11G probably benign Het
Dido1 A G 2: 180,675,013 I127T probably damaging Het
Dpp8 A T 9: 65,074,578 Y714F probably benign Het
Efcab5 G A 11: 77,137,902 A201V probably benign Het
Eif3h C T 15: 51,799,264 V129I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fars2 G A 13: 36,204,863 V112I possibly damaging Het
Fbn2 T G 18: 58,113,363 D489A probably damaging Het
Frmd4b G T 6: 97,296,267 S675R probably damaging Het
Fsip2 C T 2: 82,983,492 S3385F possibly damaging Het
Gm4758 A G 16: 36,312,637 E92G probably damaging Het
Gtpbp10 A G 5: 5,557,406 Y12H probably damaging Het
Kcng3 A G 17: 83,631,129 S164P probably damaging Het
Kifap3 T A 1: 163,857,526 L483Q probably damaging Het
Klk10 A G 7: 43,782,817 H58R probably benign Het
Kntc1 T G 5: 123,769,691 W452G probably damaging Het
Krt87 C T 15: 101,438,392 D127N possibly damaging Het
Lipm A G 19: 34,121,257 Y377C probably damaging Het
Mrc2 G A 11: 105,349,843 R1453H probably damaging Het
Nat1 T C 8: 67,491,736 F255L possibly damaging Het
Neb C T 2: 52,257,557 probably null Het
Nek5 T A 8: 22,085,460 D491V possibly damaging Het
Nynrin T C 14: 55,871,770 S1445P probably benign Het
Olfr531 C T 7: 140,400,521 C175Y probably damaging Het
Oog2 T A 4: 144,195,108 probably null Het
Pafah1b1 T C 11: 74,677,731 T391A probably benign Het
Pcdhb7 T C 18: 37,342,690 L293P probably damaging Het
Plce1 A T 19: 38,525,132 T292S probably benign Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Rfx7 A G 9: 72,618,486 Q986R possibly damaging Het
Rrp9 G T 9: 106,482,951 R186L probably benign Het
Samm50 T A 15: 84,204,097 probably null Het
Scoc T C 8: 83,437,987 D7G probably benign Het
Smad9 C T 3: 54,786,084 P145S probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snrk A G 9: 122,166,813 R553G probably damaging Het
Spata5 T A 3: 37,528,198 V794E probably damaging Het
Srcap T A 7: 127,528,550 probably null Het
Syne2 T A 12: 75,990,414 V3789E possibly damaging Het
Thsd7b T C 1: 129,816,682 I769T probably damaging Het
Tmem159 A T 7: 120,116,361 probably null Het
Ttc7 A G 17: 87,330,106 K430E probably damaging Het
Ubr4 T A 4: 139,397,214 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Yod1 T C 1: 130,719,148 V254A probably damaging Het
Zfpm2 T C 15: 41,099,397 S152P probably benign Het
Zmym2 T A 14: 56,903,004 L100H probably damaging Het
Other mutations in Vmn2r37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Vmn2r37 APN 7 9206681 missense probably benign 0.05
IGL01909:Vmn2r37 APN 7 9216033 nonsense probably null
IGL02281:Vmn2r37 APN 7 9217882 missense possibly damaging 0.95
IGL02282:Vmn2r37 APN 7 9206762 missense probably benign 0.19
IGL02513:Vmn2r37 APN 7 9217935 missense probably benign 0.14
R0136:Vmn2r37 UTSW 7 9217783 nonsense probably null
R2051:Vmn2r37 UTSW 7 9217793 missense probably damaging 1.00
R2262:Vmn2r37 UTSW 7 9217944 missense probably damaging 0.99
R3158:Vmn2r37 UTSW 7 9217714 missense probably benign 0.03
R4084:Vmn2r37 UTSW 7 9215985 missense probably benign
R4114:Vmn2r37 UTSW 7 9210093 critical splice acceptor site probably null
R5231:Vmn2r37 UTSW 7 9206595 missense possibly damaging 0.94
R5462:Vmn2r37 UTSW 7 9217974 missense probably damaging 1.00
R7104:Vmn2r37 UTSW 7 9216046 missense probably damaging 1.00
R7116:Vmn2r37 UTSW 7 9217899 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATTCATCTCATGGAGGGCATG -3'
(R):5'- ACCAAATTGTGATGTCATCCAC -3'

Sequencing Primer
(F):5'- ATGGGCTATGGCATGCAC -3'
(R):5'- CCAAATTGTGATGTCATCCACAAATG -3'
Posted On2018-05-24