Incidental Mutation 'R6437:Klk10'
ID518813
Institutional Source Beutler Lab
Gene Symbol Klk10
Ensembl Gene ENSMUSG00000030693
Gene Namekallikrein related-peptidase 10
SynonymsNES1, PRSSL1, 2300002A13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.030) question?
Stock #R6437 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43781035-43785410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43782817 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 58 (H58R)
Ref Sequence ENSEMBL: ENSMUSP00000014058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014058] [ENSMUST00000080211] [ENSMUST00000171458]
Predicted Effect probably benign
Transcript: ENSMUST00000014058
AA Change: H58R

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000014058
Gene: ENSMUSG00000030693
AA Change: H58R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Tryp_SPc 46 271 1.35e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080211
SMART Domains Protein: ENSMUSP00000079101
Gene: ENSMUSG00000067616

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Tryp_SPc 47 269 5.14e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171458
SMART Domains Protein: ENSMUSP00000132721
Gene: ENSMUSG00000067616

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 20 242 5.14e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206165
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its encoded protein is secreted and may play a role in suppression of tumorigenesis in breast and prostate cancers. Alternate splicing of this gene results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn C T 4: 156,176,778 V514I probably damaging Het
Atg16l1 T C 1: 87,790,648 L545P probably damaging Het
Ces3b T A 8: 105,092,606 D431E probably damaging Het
Cracr2a A G 6: 127,631,831 D291G probably damaging Het
Csmd2 T G 4: 127,988,100 C11G probably benign Het
Dido1 A G 2: 180,675,013 I127T probably damaging Het
Dpp8 A T 9: 65,074,578 Y714F probably benign Het
Efcab5 G A 11: 77,137,902 A201V probably benign Het
Eif3h C T 15: 51,799,264 V129I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fars2 G A 13: 36,204,863 V112I possibly damaging Het
Fbn2 T G 18: 58,113,363 D489A probably damaging Het
Frmd4b G T 6: 97,296,267 S675R probably damaging Het
Fsip2 C T 2: 82,983,492 S3385F possibly damaging Het
Gm4758 A G 16: 36,312,637 E92G probably damaging Het
Gtpbp10 A G 5: 5,557,406 Y12H probably damaging Het
Kcng3 A G 17: 83,631,129 S164P probably damaging Het
Kifap3 T A 1: 163,857,526 L483Q probably damaging Het
Kntc1 T G 5: 123,769,691 W452G probably damaging Het
Krt87 C T 15: 101,438,392 D127N possibly damaging Het
Lipm A G 19: 34,121,257 Y377C probably damaging Het
Mrc2 G A 11: 105,349,843 R1453H probably damaging Het
Nat1 T C 8: 67,491,736 F255L possibly damaging Het
Neb C T 2: 52,257,557 probably null Het
Nek5 T A 8: 22,085,460 D491V possibly damaging Het
Nynrin T C 14: 55,871,770 S1445P probably benign Het
Olfr531 C T 7: 140,400,521 C175Y probably damaging Het
Oog2 T A 4: 144,195,108 probably null Het
Pafah1b1 T C 11: 74,677,731 T391A probably benign Het
Pcdhb7 T C 18: 37,342,690 L293P probably damaging Het
Plce1 A T 19: 38,525,132 T292S probably benign Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Rfx7 A G 9: 72,618,486 Q986R possibly damaging Het
Rrp9 G T 9: 106,482,951 R186L probably benign Het
Samm50 T A 15: 84,204,097 probably null Het
Scoc T C 8: 83,437,987 D7G probably benign Het
Smad9 C T 3: 54,786,084 P145S probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snrk A G 9: 122,166,813 R553G probably damaging Het
Spata5 T A 3: 37,528,198 V794E probably damaging Het
Srcap T A 7: 127,528,550 probably null Het
Syne2 T A 12: 75,990,414 V3789E possibly damaging Het
Thsd7b T C 1: 129,816,682 I769T probably damaging Het
Tmem159 A T 7: 120,116,361 probably null Het
Ttc7 A G 17: 87,330,106 K430E probably damaging Het
Ubr4 T A 4: 139,397,214 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r37 G T 7: 9,217,851 Q338K probably damaging Het
Yod1 T C 1: 130,719,148 V254A probably damaging Het
Zfpm2 T C 15: 41,099,397 S152P probably benign Het
Zmym2 T A 14: 56,903,004 L100H probably damaging Het
Other mutations in Klk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Klk10 APN 7 43784976 missense probably damaging 1.00
IGL01657:Klk10 APN 7 43781589 missense possibly damaging 0.49
IGL02049:Klk10 APN 7 43784458 splice site probably benign
IGL02725:Klk10 APN 7 43781620 missense probably damaging 1.00
IGL03382:Klk10 APN 7 43784459 splice site probably benign
R0433:Klk10 UTSW 7 43781565 missense possibly damaging 0.51
R1521:Klk10 UTSW 7 43782880 missense probably benign 0.00
R1580:Klk10 UTSW 7 43782862 missense probably damaging 1.00
R4825:Klk10 UTSW 7 43783598 missense probably damaging 1.00
R5969:Klk10 UTSW 7 43784985 missense probably damaging 1.00
R6641:Klk10 UTSW 7 43784900 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACGGCTTACTACTCAGCTGC -3'
(R):5'- CTCTTGTAGAATGGCTGCCAC -3'

Sequencing Primer
(F):5'- ACTACTCAGCTGCGCCCC -3'
(R):5'- TGTAGAATGGCTGCCACCCTTAAC -3'
Posted On2018-05-24