Incidental Mutation 'R6437:Olfr531'
ID518817
Institutional Source Beutler Lab
Gene Symbol Olfr531
Ensembl Gene ENSMUSG00000062712
Gene Nameolfactory receptor 531
SynonymsGA_x6K02T2PBJ9-42551260-42550346, MOR251-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.035) question?
Stock #R6437 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140399045-140402918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 140400521 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 175 (C175Y)
Ref Sequence ENSEMBL: ENSMUSP00000149942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080153] [ENSMUST00000216053] [ENSMUST00000217167]
Predicted Effect probably damaging
Transcript: ENSMUST00000080153
AA Change: C175Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079048
Gene: ENSMUSG00000062712
AA Change: C175Y

DomainStartEndE-ValueType
Pfam:7tm_4 28 303 6.3e-46 PFAM
Pfam:7tm_1 38 286 1.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216053
AA Change: C175Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217032
Predicted Effect probably damaging
Transcript: ENSMUST00000217167
AA Change: C175Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn C T 4: 156,176,778 V514I probably damaging Het
Atg16l1 T C 1: 87,790,648 L545P probably damaging Het
Ces3b T A 8: 105,092,606 D431E probably damaging Het
Cracr2a A G 6: 127,631,831 D291G probably damaging Het
Csmd2 T G 4: 127,988,100 C11G probably benign Het
Dido1 A G 2: 180,675,013 I127T probably damaging Het
Dpp8 A T 9: 65,074,578 Y714F probably benign Het
Efcab5 G A 11: 77,137,902 A201V probably benign Het
Eif3h C T 15: 51,799,264 V129I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fars2 G A 13: 36,204,863 V112I possibly damaging Het
Fbn2 T G 18: 58,113,363 D489A probably damaging Het
Frmd4b G T 6: 97,296,267 S675R probably damaging Het
Fsip2 C T 2: 82,983,492 S3385F possibly damaging Het
Gm4758 A G 16: 36,312,637 E92G probably damaging Het
Gtpbp10 A G 5: 5,557,406 Y12H probably damaging Het
Kcng3 A G 17: 83,631,129 S164P probably damaging Het
Kifap3 T A 1: 163,857,526 L483Q probably damaging Het
Klk10 A G 7: 43,782,817 H58R probably benign Het
Kntc1 T G 5: 123,769,691 W452G probably damaging Het
Krt87 C T 15: 101,438,392 D127N possibly damaging Het
Lipm A G 19: 34,121,257 Y377C probably damaging Het
Mrc2 G A 11: 105,349,843 R1453H probably damaging Het
Nat1 T C 8: 67,491,736 F255L possibly damaging Het
Neb C T 2: 52,257,557 probably null Het
Nek5 T A 8: 22,085,460 D491V possibly damaging Het
Nynrin T C 14: 55,871,770 S1445P probably benign Het
Oog2 T A 4: 144,195,108 probably null Het
Pafah1b1 T C 11: 74,677,731 T391A probably benign Het
Pcdhb7 T C 18: 37,342,690 L293P probably damaging Het
Plce1 A T 19: 38,525,132 T292S probably benign Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Rfx7 A G 9: 72,618,486 Q986R possibly damaging Het
Rrp9 G T 9: 106,482,951 R186L probably benign Het
Samm50 T A 15: 84,204,097 probably null Het
Scoc T C 8: 83,437,987 D7G probably benign Het
Smad9 C T 3: 54,786,084 P145S probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snrk A G 9: 122,166,813 R553G probably damaging Het
Spata5 T A 3: 37,528,198 V794E probably damaging Het
Srcap T A 7: 127,528,550 probably null Het
Syne2 T A 12: 75,990,414 V3789E possibly damaging Het
Thsd7b T C 1: 129,816,682 I769T probably damaging Het
Tmem159 A T 7: 120,116,361 probably null Het
Ttc7 A G 17: 87,330,106 K430E probably damaging Het
Ubr4 T A 4: 139,397,214 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r37 G T 7: 9,217,851 Q338K probably damaging Het
Yod1 T C 1: 130,719,148 V254A probably damaging Het
Zfpm2 T C 15: 41,099,397 S152P probably benign Het
Zmym2 T A 14: 56,903,004 L100H probably damaging Het
Other mutations in Olfr531
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01750:Olfr531 APN 7 140400657 missense probably benign
IGL02190:Olfr531 APN 7 140400120 utr 3 prime probably benign
IGL02548:Olfr531 APN 7 140400662 missense probably damaging 1.00
R0200:Olfr531 UTSW 7 140400875 missense probably damaging 1.00
R0589:Olfr531 UTSW 7 140400900 missense possibly damaging 0.94
R1325:Olfr531 UTSW 7 140400881 missense probably damaging 1.00
R1985:Olfr531 UTSW 7 140400800 missense possibly damaging 0.68
R4671:Olfr531 UTSW 7 140400305 missense probably damaging 1.00
R4754:Olfr531 UTSW 7 140400159 missense probably damaging 0.99
R4941:Olfr531 UTSW 7 140400879 missense probably benign 0.24
R5015:Olfr531 UTSW 7 140400170 missense probably damaging 0.99
R5070:Olfr531 UTSW 7 140400569 missense probably benign 0.00
R5244:Olfr531 UTSW 7 140400138 missense probably benign 0.00
R5883:Olfr531 UTSW 7 140400188 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGGTGACCACGATGAGG -3'
(R):5'- TATGGCCTATGACCGCTTTG -3'

Sequencing Primer
(F):5'- TGACCACGATGAGGTGTGC -3'
(R):5'- ATGACCGCTTTGTGGCC -3'
Posted On2018-05-24