Incidental Mutation 'R6437:Pafah1b1'
ID518826
Institutional Source Beutler Lab
Gene Symbol Pafah1b1
Ensembl Gene ENSMUSG00000020745
Gene Nameplatelet-activating factor acetylhydrolase, isoform 1b, subunit 1
SynonymsPafaha, lissencephaly-1 protein, Mdsh, PAF-AH 45, LIS-1, Lis1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6437 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74673949-74724670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74677731 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 391 (T391A)
Ref Sequence ENSEMBL: ENSMUSP00000099578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021091] [ENSMUST00000102520]
Predicted Effect probably benign
Transcript: ENSMUST00000021091
AA Change: T391A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021091
Gene: ENSMUSG00000020745
AA Change: T391A

DomainStartEndE-ValueType
LisH 7 39 6.12e-7 SMART
WD40 97 136 2.1e-7 SMART
WD40 139 178 9.73e-12 SMART
WD40 181 220 1.1e-10 SMART
WD40 223 262 9.3e-9 SMART
WD40 265 324 4.65e-9 SMART
WD40 327 366 4.11e-10 SMART
WD40 369 408 8.81e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102520
AA Change: T391A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099578
Gene: ENSMUSG00000020745
AA Change: T391A

DomainStartEndE-ValueType
LisH 7 39 6.12e-7 SMART
WD40 97 136 2.1e-7 SMART
WD40 139 178 9.73e-12 SMART
WD40 181 220 1.1e-10 SMART
WD40 223 262 9.3e-9 SMART
WD40 265 324 4.65e-9 SMART
WD40 327 366 4.11e-10 SMART
WD40 369 408 8.81e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156794
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus was identified as encoding a gene that when mutated or lost caused the lissencephaly associated with Miller-Dieker lissencephaly syndrome. This gene encodes the non-catalytic alpha subunit of the intracellular Ib isoform of platelet-activating factor acteylhydrolase, a heterotrimeric enzyme that specifically catalyzes the removal of the acetyl group at the SN-2 position of platelet-activating factor (identified as 1-O-alkyl-2-acetyl-sn-glyceryl-3-phosphorylcholine). Two other isoforms of intracellular platelet-activating factor acetylhydrolase exist: one composed of multiple subunits, the other, a single subunit. In addition, a single-subunit isoform of this enzyme is found in serum. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mutations at this locus result in neuronal migration defects. Homozygous null mutants die around implantation. Different allelic combinations show variable cortical, hippocampal and olfactory disorganization and impaired spatial learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn C T 4: 156,176,778 V514I probably damaging Het
Atg16l1 T C 1: 87,790,648 L545P probably damaging Het
Ces3b T A 8: 105,092,606 D431E probably damaging Het
Cracr2a A G 6: 127,631,831 D291G probably damaging Het
Csmd2 T G 4: 127,988,100 C11G probably benign Het
Dido1 A G 2: 180,675,013 I127T probably damaging Het
Dpp8 A T 9: 65,074,578 Y714F probably benign Het
Efcab5 G A 11: 77,137,902 A201V probably benign Het
Eif3h C T 15: 51,799,264 V129I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fars2 G A 13: 36,204,863 V112I possibly damaging Het
Fbn2 T G 18: 58,113,363 D489A probably damaging Het
Frmd4b G T 6: 97,296,267 S675R probably damaging Het
Fsip2 C T 2: 82,983,492 S3385F possibly damaging Het
Gm4758 A G 16: 36,312,637 E92G probably damaging Het
Gtpbp10 A G 5: 5,557,406 Y12H probably damaging Het
Kcng3 A G 17: 83,631,129 S164P probably damaging Het
Kifap3 T A 1: 163,857,526 L483Q probably damaging Het
Klk10 A G 7: 43,782,817 H58R probably benign Het
Kntc1 T G 5: 123,769,691 W452G probably damaging Het
Krt87 C T 15: 101,438,392 D127N possibly damaging Het
Lipm A G 19: 34,121,257 Y377C probably damaging Het
Mrc2 G A 11: 105,349,843 R1453H probably damaging Het
Nat1 T C 8: 67,491,736 F255L possibly damaging Het
Neb C T 2: 52,257,557 probably null Het
Nek5 T A 8: 22,085,460 D491V possibly damaging Het
Nynrin T C 14: 55,871,770 S1445P probably benign Het
Olfr531 C T 7: 140,400,521 C175Y probably damaging Het
Oog2 T A 4: 144,195,108 probably null Het
Pcdhb7 T C 18: 37,342,690 L293P probably damaging Het
Plce1 A T 19: 38,525,132 T292S probably benign Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Rfx7 A G 9: 72,618,486 Q986R possibly damaging Het
Rrp9 G T 9: 106,482,951 R186L probably benign Het
Samm50 T A 15: 84,204,097 probably null Het
Scoc T C 8: 83,437,987 D7G probably benign Het
Smad9 C T 3: 54,786,084 P145S probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snrk A G 9: 122,166,813 R553G probably damaging Het
Spata5 T A 3: 37,528,198 V794E probably damaging Het
Srcap T A 7: 127,528,550 probably null Het
Syne2 T A 12: 75,990,414 V3789E possibly damaging Het
Thsd7b T C 1: 129,816,682 I769T probably damaging Het
Tmem159 A T 7: 120,116,361 probably null Het
Ttc7 A G 17: 87,330,106 K430E probably damaging Het
Ubr4 T A 4: 139,397,214 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r37 G T 7: 9,217,851 Q338K probably damaging Het
Yod1 T C 1: 130,719,148 V254A probably damaging Het
Zfpm2 T C 15: 41,099,397 S152P probably benign Het
Zmym2 T A 14: 56,903,004 L100H probably damaging Het
Other mutations in Pafah1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pafah1b1 APN 11 74683647 missense probably damaging 1.00
IGL01861:Pafah1b1 APN 11 74690577 missense possibly damaging 0.81
IGL02082:Pafah1b1 APN 11 74699333 missense probably benign 0.33
IGL03180:Pafah1b1 APN 11 74683518 missense possibly damaging 0.80
hotspur UTSW 11 74682272 missense probably benign 0.02
picador UTSW 11 74677731 missense probably benign
R0362:Pafah1b1 UTSW 11 74683631 missense probably benign 0.01
R0462:Pafah1b1 UTSW 11 74677715 missense probably benign 0.00
R1962:Pafah1b1 UTSW 11 74699351 start gained probably benign
R3176:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R3276:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R3615:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R3616:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R4326:Pafah1b1 UTSW 11 74682240 missense probably benign 0.04
R4327:Pafah1b1 UTSW 11 74682240 missense probably benign 0.04
R4328:Pafah1b1 UTSW 11 74682240 missense probably benign 0.04
R4776:Pafah1b1 UTSW 11 74685871 unclassified probably benign
R4985:Pafah1b1 UTSW 11 74685988 missense probably damaging 1.00
R5128:Pafah1b1 UTSW 11 74679436 intron probably benign
R5148:Pafah1b1 UTSW 11 74684452 missense probably damaging 0.99
R6406:Pafah1b1 UTSW 11 74682272 missense probably benign 0.02
R7229:Pafah1b1 UTSW 11 74682278 missense probably damaging 0.99
X0064:Pafah1b1 UTSW 11 74689183 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CACCATGCATGAATACTTTGTGTG -3'
(R):5'- GCAGAGGTTCATAGACTCCC -3'

Sequencing Primer
(F):5'- CATCAGAGTGCATCCAGA -3'
(R):5'- AGGTTCATAGACTCCCAGAGCTTG -3'
Posted On2018-05-24