Incidental Mutation 'R6437:Kcng3'
ID518840
Institutional Source Beutler Lab
Gene Symbol Kcng3
Ensembl Gene ENSMUSG00000045053
Gene Namepotassium voltage-gated channel, subfamily G, member 3
SynonymsKv10.1a, Kv10.1b, KV6.3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R6437 (G1)
Quality Score90.1426
Status Validated
Chromosome17
Chromosomal Location83585957-83631895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83631129 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 164 (S164P)
Ref Sequence ENSEMBL: ENSMUSP00000054910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051482]
Predicted Effect probably damaging
Transcript: ENSMUST00000051482
AA Change: S164P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054910
Gene: ENSMUSG00000045053
AA Change: S164P

DomainStartEndE-ValueType
BTB 9 119 5.2e-5 SMART
Pfam:Ion_trans 167 417 4.6e-42 PFAM
Pfam:Ion_trans_2 321 411 4.3e-13 PFAM
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member is a gamma subunit functioning as a modulatory molecule. Alternative splicing results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn C T 4: 156,176,778 V514I probably damaging Het
Atg16l1 T C 1: 87,790,648 L545P probably damaging Het
Ces3b T A 8: 105,092,606 D431E probably damaging Het
Cracr2a A G 6: 127,631,831 D291G probably damaging Het
Csmd2 T G 4: 127,988,100 C11G probably benign Het
Dido1 A G 2: 180,675,013 I127T probably damaging Het
Dpp8 A T 9: 65,074,578 Y714F probably benign Het
Efcab5 G A 11: 77,137,902 A201V probably benign Het
Eif3h C T 15: 51,799,264 V129I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fars2 G A 13: 36,204,863 V112I possibly damaging Het
Fbn2 T G 18: 58,113,363 D489A probably damaging Het
Frmd4b G T 6: 97,296,267 S675R probably damaging Het
Fsip2 C T 2: 82,983,492 S3385F possibly damaging Het
Gm4758 A G 16: 36,312,637 E92G probably damaging Het
Gtpbp10 A G 5: 5,557,406 Y12H probably damaging Het
Kifap3 T A 1: 163,857,526 L483Q probably damaging Het
Klk10 A G 7: 43,782,817 H58R probably benign Het
Kntc1 T G 5: 123,769,691 W452G probably damaging Het
Krt87 C T 15: 101,438,392 D127N possibly damaging Het
Lipm A G 19: 34,121,257 Y377C probably damaging Het
Mrc2 G A 11: 105,349,843 R1453H probably damaging Het
Nat1 T C 8: 67,491,736 F255L possibly damaging Het
Neb C T 2: 52,257,557 probably null Het
Nek5 T A 8: 22,085,460 D491V possibly damaging Het
Nynrin T C 14: 55,871,770 S1445P probably benign Het
Olfr531 C T 7: 140,400,521 C175Y probably damaging Het
Oog2 T A 4: 144,195,108 probably null Het
Pafah1b1 T C 11: 74,677,731 T391A probably benign Het
Pcdhb7 T C 18: 37,342,690 L293P probably damaging Het
Plce1 A T 19: 38,525,132 T292S probably benign Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Rfx7 A G 9: 72,618,486 Q986R possibly damaging Het
Rrp9 G T 9: 106,482,951 R186L probably benign Het
Samm50 T A 15: 84,204,097 probably null Het
Scoc T C 8: 83,437,987 D7G probably benign Het
Smad9 C T 3: 54,786,084 P145S probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snrk A G 9: 122,166,813 R553G probably damaging Het
Spata5 T A 3: 37,528,198 V794E probably damaging Het
Srcap T A 7: 127,528,550 probably null Het
Syne2 T A 12: 75,990,414 V3789E possibly damaging Het
Thsd7b T C 1: 129,816,682 I769T probably damaging Het
Tmem159 A T 7: 120,116,361 probably null Het
Ttc7 A G 17: 87,330,106 K430E probably damaging Het
Ubr4 T A 4: 139,397,214 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r37 G T 7: 9,217,851 Q338K probably damaging Het
Yod1 T C 1: 130,719,148 V254A probably damaging Het
Zfpm2 T C 15: 41,099,397 S152P probably benign Het
Zmym2 T A 14: 56,903,004 L100H probably damaging Het
Other mutations in Kcng3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Kcng3 APN 17 83587850 missense probably damaging 1.00
PIT4403001:Kcng3 UTSW 17 83588182 missense probably damaging 1.00
R0034:Kcng3 UTSW 17 83588383 splice site probably benign
R0056:Kcng3 UTSW 17 83587756 missense probably damaging 0.98
R0335:Kcng3 UTSW 17 83587737 missense possibly damaging 0.51
R1224:Kcng3 UTSW 17 83631395 missense probably damaging 1.00
R1462:Kcng3 UTSW 17 83631063 missense probably damaging 0.96
R1601:Kcng3 UTSW 17 83588339 missense probably damaging 1.00
R3147:Kcng3 UTSW 17 83588320 missense possibly damaging 0.71
R4854:Kcng3 UTSW 17 83588306 missense probably damaging 0.97
R5408:Kcng3 UTSW 17 83631005 missense probably benign 0.12
R5719:Kcng3 UTSW 17 83631134 missense possibly damaging 0.71
R5791:Kcng3 UTSW 17 83588210 missense probably benign 0.02
R6155:Kcng3 UTSW 17 83588378 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAAGCAGTGCGTCCTACC -3'
(R):5'- TCTCCTTCTACAACGAGATGATCTAC -3'

Sequencing Primer
(F):5'- AGTGCGTCCTACCCGGAG -3'
(R):5'- TCTACAACGAGATGATCTACTGGGG -3'
Posted On2018-05-24