Incidental Mutation 'R6437:Pcdhb7'
ID518842
Institutional Source Beutler Lab
Gene Symbol Pcdhb7
Ensembl Gene ENSMUSG00000045062
Gene Nameprotocadherin beta 7
SynonymsPcdhb4B, PcdhbG
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6437 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37341702-37345202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37342690 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 293 (L293P)
Ref Sequence ENSEMBL: ENSMUSP00000051041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053037] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000053037
AA Change: L293P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051041
Gene: ENSMUSG00000045062
AA Change: L293P

DomainStartEndE-ValueType
Pfam:Cadherin_2 61 143 1.4e-32 PFAM
CA 186 271 5.47e-17 SMART
CA 295 376 4.43e-26 SMART
CA 399 480 1.04e-22 SMART
CA 504 590 2.12e-23 SMART
CA 620 701 5.73e-11 SMART
Pfam:Cadherin_C_2 718 801 5.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn C T 4: 156,176,778 V514I probably damaging Het
Atg16l1 T C 1: 87,790,648 L545P probably damaging Het
Ces3b T A 8: 105,092,606 D431E probably damaging Het
Cracr2a A G 6: 127,631,831 D291G probably damaging Het
Csmd2 T G 4: 127,988,100 C11G probably benign Het
Dido1 A G 2: 180,675,013 I127T probably damaging Het
Dpp8 A T 9: 65,074,578 Y714F probably benign Het
Efcab5 G A 11: 77,137,902 A201V probably benign Het
Eif3h C T 15: 51,799,264 V129I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fars2 G A 13: 36,204,863 V112I possibly damaging Het
Fbn2 T G 18: 58,113,363 D489A probably damaging Het
Frmd4b G T 6: 97,296,267 S675R probably damaging Het
Fsip2 C T 2: 82,983,492 S3385F possibly damaging Het
Gm4758 A G 16: 36,312,637 E92G probably damaging Het
Gtpbp10 A G 5: 5,557,406 Y12H probably damaging Het
Kcng3 A G 17: 83,631,129 S164P probably damaging Het
Kifap3 T A 1: 163,857,526 L483Q probably damaging Het
Klk10 A G 7: 43,782,817 H58R probably benign Het
Kntc1 T G 5: 123,769,691 W452G probably damaging Het
Krt87 C T 15: 101,438,392 D127N possibly damaging Het
Lipm A G 19: 34,121,257 Y377C probably damaging Het
Mrc2 G A 11: 105,349,843 R1453H probably damaging Het
Nat1 T C 8: 67,491,736 F255L possibly damaging Het
Neb C T 2: 52,257,557 probably null Het
Nek5 T A 8: 22,085,460 D491V possibly damaging Het
Nynrin T C 14: 55,871,770 S1445P probably benign Het
Olfr531 C T 7: 140,400,521 C175Y probably damaging Het
Oog2 T A 4: 144,195,108 probably null Het
Pafah1b1 T C 11: 74,677,731 T391A probably benign Het
Plce1 A T 19: 38,525,132 T292S probably benign Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Rfx7 A G 9: 72,618,486 Q986R possibly damaging Het
Rrp9 G T 9: 106,482,951 R186L probably benign Het
Samm50 T A 15: 84,204,097 probably null Het
Scoc T C 8: 83,437,987 D7G probably benign Het
Smad9 C T 3: 54,786,084 P145S probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snrk A G 9: 122,166,813 R553G probably damaging Het
Spata5 T A 3: 37,528,198 V794E probably damaging Het
Srcap T A 7: 127,528,550 probably null Het
Syne2 T A 12: 75,990,414 V3789E possibly damaging Het
Thsd7b T C 1: 129,816,682 I769T probably damaging Het
Tmem159 A T 7: 120,116,361 probably null Het
Ttc7 A G 17: 87,330,106 K430E probably damaging Het
Ubr4 T A 4: 139,397,214 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r37 G T 7: 9,217,851 Q338K probably damaging Het
Yod1 T C 1: 130,719,148 V254A probably damaging Het
Zfpm2 T C 15: 41,099,397 S152P probably benign Het
Zmym2 T A 14: 56,903,004 L100H probably damaging Het
Other mutations in Pcdhb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Pcdhb7 APN 18 37343152 missense probably benign 0.35
IGL01806:Pcdhb7 APN 18 37342495 missense possibly damaging 0.60
IGL01862:Pcdhb7 APN 18 37343862 missense possibly damaging 0.81
IGL01961:Pcdhb7 APN 18 37342473 missense probably damaging 1.00
R0184:Pcdhb7 UTSW 18 37343390 missense probably benign 0.44
R0426:Pcdhb7 UTSW 18 37342804 missense probably damaging 0.99
R0576:Pcdhb7 UTSW 18 37342357 missense probably benign 0.01
R0646:Pcdhb7 UTSW 18 37343389 missense probably damaging 1.00
R0656:Pcdhb7 UTSW 18 37341901 missense probably benign 0.01
R1216:Pcdhb7 UTSW 18 37343874 missense probably damaging 0.99
R1851:Pcdhb7 UTSW 18 37342578 missense possibly damaging 0.69
R2168:Pcdhb7 UTSW 18 37343282 missense probably benign 0.05
R2312:Pcdhb7 UTSW 18 37342197 missense probably benign
R3153:Pcdhb7 UTSW 18 37343073 missense probably damaging 1.00
R3758:Pcdhb7 UTSW 18 37343026 missense possibly damaging 0.84
R3763:Pcdhb7 UTSW 18 37341883 missense probably benign
R3940:Pcdhb7 UTSW 18 37343968 missense probably damaging 1.00
R3949:Pcdhb7 UTSW 18 37343088 missense probably benign 0.00
R4418:Pcdhb7 UTSW 18 37343482 missense probably benign 0.08
R4580:Pcdhb7 UTSW 18 37342135 missense probably damaging 1.00
R4880:Pcdhb7 UTSW 18 37342231 missense probably benign 0.00
R4936:Pcdhb7 UTSW 18 37342149 nonsense probably null
R4936:Pcdhb7 UTSW 18 37342150 missense probably damaging 1.00
R5086:Pcdhb7 UTSW 18 37343109 missense possibly damaging 0.56
R5517:Pcdhb7 UTSW 18 37341793 intron probably benign
R5570:Pcdhb7 UTSW 18 37344171 missense probably benign 0.35
R5827:Pcdhb7 UTSW 18 37342024 missense probably benign 0.14
R6187:Pcdhb7 UTSW 18 37342569 missense probably benign 0.23
R6194:Pcdhb7 UTSW 18 37342146 missense probably damaging 0.98
R6195:Pcdhb7 UTSW 18 37342656 missense probably benign 0.33
R6373:Pcdhb7 UTSW 18 37342211 nonsense probably null
R6398:Pcdhb7 UTSW 18 37343434 missense possibly damaging 0.86
R6587:Pcdhb7 UTSW 18 37344103 missense probably benign
R6596:Pcdhb7 UTSW 18 37343361 missense probably damaging 0.97
R6646:Pcdhb7 UTSW 18 37343974 missense possibly damaging 0.90
R6702:Pcdhb7 UTSW 18 37341906 missense probably benign 0.03
R6923:Pcdhb7 UTSW 18 37342469 intron probably null
R6976:Pcdhb7 UTSW 18 37343578 missense probably benign 0.12
R7038:Pcdhb7 UTSW 18 37342204 missense possibly damaging 0.90
R7325:Pcdhb7 UTSW 18 37343387 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAATACCCAGAGTTGGTGCAGG -3'
(R):5'- CCGTGGCCTCAATTTTCACATG -3'

Sequencing Primer
(F):5'- TTGGTGCAGGACAGAGCC -3'
(R):5'- TGAGAACGTTCTCTGGAT -3'
Posted On2018-05-24