Incidental Mutation 'R6438:Erich3'
ID518850
Institutional Source Beutler Lab
Gene Symbol Erich3
Ensembl Gene ENSMUSG00000078161
Gene Nameglutamate rich 3
Synonyms4922501L14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6438 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location154663859-154767790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154695753 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 13 (Y13F)
Ref Sequence ENSEMBL: ENSMUSP00000096097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098496]
Predicted Effect probably damaging
Transcript: ENSMUST00000098496
AA Change: Y13F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096097
Gene: ENSMUSG00000078161
AA Change: Y13F

DomainStartEndE-ValueType
internal_repeat_1 18 102 3.73e-10 PROSPERO
internal_repeat_1 155 240 3.73e-10 PROSPERO
low complexity region 501 514 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik C T 14: 8,431,701 V644M probably damaging Het
Ado A T 10: 67,548,541 I78N probably damaging Het
Arhgap18 T C 10: 26,772,698 probably null Het
Arl11 A G 14: 61,310,944 T68A probably benign Het
Atxn2 T A 5: 121,779,432 I463N probably damaging Het
B3gnt4 G A 5: 123,511,591 E340K probably benign Het
C1ra C T 6: 124,513,777 T43I possibly damaging Het
C6 T A 15: 4,796,983 Y683N possibly damaging Het
Cdk12 T A 11: 98,224,467 Y811* probably null Het
Chd9 A T 8: 90,998,521 E1159D probably benign Het
Efcab7 T A 4: 99,909,772 S505T probably benign Het
Esco1 A T 18: 10,572,031 C770S probably damaging Het
Evpl C A 11: 116,230,101 R436L probably benign Het
Fam185a T A 5: 21,458,972 probably null Het
Gm16432 T C 1: 178,111,303 Y581H possibly damaging Het
Gm17078 A G 14: 51,611,238 V14A probably benign Het
Hectd2 T C 19: 36,618,842 *776Q probably null Het
Ldb2 T C 5: 44,480,310 R219G probably damaging Het
Lrrn4 T C 2: 132,870,142 E587G probably damaging Het
Malrd1 T C 2: 15,614,206 S294P probably benign Het
Map7 A G 10: 20,267,257 E384G unknown Het
Miga1 T C 3: 152,322,403 D163G probably damaging Het
Myo7b G A 18: 31,966,329 S1680F probably damaging Het
Nell2 C T 15: 95,232,498 V665M probably damaging Het
Npas3 T C 12: 54,068,698 V770A probably damaging Het
Pcm1 C T 8: 41,325,381 R1818W possibly damaging Het
Slc4a9 T A 18: 36,535,687 N701K probably benign Het
Slc5a9 A G 4: 111,891,825 V187A probably benign Het
Slf1 A T 13: 77,066,606 C654S probably damaging Het
Srek1ip1 A G 13: 104,837,370 Y95C probably benign Het
Synpo2l A G 14: 20,661,136 V472A probably benign Het
Tmem168 A T 6: 13,602,674 I231N probably benign Het
Usp34 T C 11: 23,364,266 M717T probably benign Het
Zfp672 T C 11: 58,316,737 T253A probably benign Het
Other mutations in Erich3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Erich3 APN 3 154748519 missense probably benign 0.44
IGL01141:Erich3 APN 3 154714016 missense probably benign 0.08
IGL01812:Erich3 APN 3 154713971 missense possibly damaging 0.70
IGL02126:Erich3 APN 3 154713962 missense possibly damaging 0.60
IGL03371:Erich3 APN 3 154727477 missense probably damaging 0.97
IGL03386:Erich3 APN 3 154739239 missense possibly damaging 0.80
FR4449:Erich3 UTSW 3 154763513 unclassified probably benign
R0942:Erich3 UTSW 3 154739151 missense probably benign 0.00
R1558:Erich3 UTSW 3 154714068 missense probably damaging 0.99
R1582:Erich3 UTSW 3 154764323 unclassified probably benign
R1674:Erich3 UTSW 3 154762623 unclassified probably benign
R1676:Erich3 UTSW 3 154762623 unclassified probably benign
R1724:Erich3 UTSW 3 154762327 missense possibly damaging 0.89
R1757:Erich3 UTSW 3 154695765 missense probably damaging 0.98
R1771:Erich3 UTSW 3 154748472 missense possibly damaging 0.82
R2384:Erich3 UTSW 3 154764651 missense possibly damaging 0.92
R2410:Erich3 UTSW 3 154733603 missense probably damaging 0.98
R2507:Erich3 UTSW 3 154698659 missense probably null 1.00
R3621:Erich3 UTSW 3 154748732 missense possibly damaging 0.83
R3755:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764578 missense possibly damaging 0.66
R3832:Erich3 UTSW 3 154762361 missense probably damaging 0.97
R4020:Erich3 UTSW 3 154714049 missense probably damaging 0.97
R4601:Erich3 UTSW 3 154764738 missense unknown
R4628:Erich3 UTSW 3 154763687 missense probably damaging 1.00
R4841:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4842:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4863:Erich3 UTSW 3 154764804 missense unknown
R4989:Erich3 UTSW 3 154748388 missense possibly damaging 0.85
R5310:Erich3 UTSW 3 154763580 missense probably damaging 1.00
R5596:Erich3 UTSW 3 154727396 missense probably damaging 0.99
R5695:Erich3 UTSW 3 154733573 missense probably damaging 1.00
R5742:Erich3 UTSW 3 154733323 missense probably damaging 1.00
R5859:Erich3 UTSW 3 154762497 missense possibly damaging 0.90
R5916:Erich3 UTSW 3 154695823 missense probably damaging 1.00
R6172:Erich3 UTSW 3 154764341 missense possibly damaging 0.66
R6321:Erich3 UTSW 3 154727502 missense probably damaging 1.00
R6520:Erich3 UTSW 3 154763465 missense probably damaging 0.98
R6679:Erich3 UTSW 3 154762429 missense possibly damaging 0.81
R6697:Erich3 UTSW 3 154764270 unclassified probably benign
R6800:Erich3 UTSW 3 154727392 critical splice acceptor site probably null
R6823:Erich3 UTSW 3 154727437 missense probably damaging 1.00
R6855:Erich3 UTSW 3 154762649 nonsense probably null
R6989:Erich3 UTSW 3 154763677 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCAGCTGACTGTTGTACCTG -3'
(R):5'- TCTCCTTTGTTTAGAAAGAGCTCC -3'

Sequencing Primer
(F):5'- GTCTTCAAATGCATCGTTGGC -3'
(R):5'- TAAGGAGAAAAAGATGTCACAGACTC -3'
Posted On2018-05-24