Incidental Mutation 'R6439:Jak2'
List |< first << previous [record 98 of 217] next >> last >|
ID518955
Institutional Source Beutler Lab
Gene Symbol Jak2
Ensembl Gene ENSMUSG00000024789
Gene NameJanus kinase 2
SynonymsC81284
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6439 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location29251828-29313080 bp(+) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) C to T at 29309622 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000064394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025705] [ENSMUST00000065796]
Predicted Effect probably null
Transcript: ENSMUST00000025705
SMART Domains Protein: ENSMUSP00000025705
Gene: ENSMUSG00000024789

DomainStartEndE-ValueType
B41 33 270 8.86e-56 SMART
SH2 397 487 3.03e-18 SMART
STYKc 545 805 1.95e-26 SMART
TyrKc 849 1123 8.61e-119 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065796
SMART Domains Protein: ENSMUSP00000064394
Gene: ENSMUSG00000024789

DomainStartEndE-ValueType
B41 33 270 8.86e-56 SMART
SH2 397 487 3.03e-18 SMART
STYKc 545 805 1.95e-26 SMART
TyrKc 849 1123 8.61e-119 SMART
Meta Mutation Damage Score 0.664 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a protein tyrosine kinase involved in a specific subset of cytokine receptor signaling pathways. It has been found to be constituitively associated with the prolactin receptor and is required for responses to gamma interferon. Mice that do not express an active protein for this gene exhibit embryonic lethality associated with the absence of definitive erythropoiesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations die during midgestation due to a failure of erythropoieses. Mice expressing a conditional allele activated in mammary tissue exhibit lactation deficiency due to impaired alveologenesis. Mice homozygous for a knock-in allele exhibit myeloproliferative neoplasm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik T C 15: 58,032,048 D18G probably null Het
A530064D06Rik A G 17: 48,166,485 V88A probably damaging Het
Abhd6 T C 14: 8,055,589 L272P probably damaging Het
Adam25 C T 8: 40,754,590 R298C possibly damaging Het
Afap1l2 T C 19: 56,928,386 N219D possibly damaging Het
Brd3 A G 2: 27,463,926 F58S probably damaging Het
Ceacam3 G A 7: 17,158,328 R332H possibly damaging Het
Cfap57 C A 4: 118,588,975 probably null Het
Chd2 A G 7: 73,480,406 F834L probably damaging Het
Crocc2 A G 1: 93,183,404 K140E possibly damaging Het
Fam117b A G 1: 59,981,572 T534A probably benign Het
Fchsd1 C T 18: 37,969,434 V14I probably damaging Het
Gm5346 T C 8: 43,625,951 N412S probably damaging Het
Grid2ip A T 5: 143,373,502 E291V probably damaging Het
Hbp1 A G 12: 31,937,721 L146S probably damaging Het
Hr A G 14: 70,561,836 D616G possibly damaging Het
Igfbp5 A C 1: 72,863,141 probably null Het
Mpl T C 4: 118,448,553 D425G probably damaging Het
Ms4a4c T C 19: 11,421,312 S165P probably benign Het
Mycbp2 A G 14: 103,155,475 S3217P probably benign Het
Nfatc3 T A 8: 106,083,870 L426* probably null Het
Olfr1317 T C 2: 112,142,164 V73A probably benign Het
Olfr8 T A 10: 78,955,984 Y260N probably damaging Het
Olfr994 T C 2: 85,430,724 Y35C probably damaging Het
Phf1 G T 17: 26,936,612 V384L probably benign Het
Rangap1 T C 15: 81,712,135 T259A probably benign Het
Rec8 A G 14: 55,618,619 N6S possibly damaging Het
Rmdn2 G A 17: 79,627,542 probably benign Het
Scin T C 12: 40,068,946 Y617C probably damaging Het
Ttc13 T C 8: 124,673,482 S744G probably benign Het
Ttc14 T C 3: 33,808,819 probably benign Het
Uggt1 T C 1: 36,174,951 E219G possibly damaging Het
Vmn1r183 A G 7: 24,055,279 D169G possibly damaging Het
Vmn1r72 A T 7: 11,679,137 probably null Het
Zfp326 T G 5: 105,888,718 M76R probably null Het
Other mutations in Jak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Jak2 APN 19 29301647 missense probably damaging 1.00
IGL00951:Jak2 APN 19 29299583 missense probably damaging 1.00
IGL01300:Jak2 APN 19 29309683 missense probably damaging 1.00
IGL01800:Jak2 APN 19 29286293 splice site probably benign
IGL02035:Jak2 APN 19 29286408 missense probably benign 0.24
IGL02212:Jak2 APN 19 29287982 missense probably benign 0.01
IGL02447:Jak2 APN 19 29299614 missense probably damaging 1.00
R0001:Jak2 UTSW 19 29282387 missense probably benign 0.01
R0158:Jak2 UTSW 19 29311757 missense probably benign
R0217:Jak2 UTSW 19 29296650 critical splice donor site probably null
R0308:Jak2 UTSW 19 29311757 missense probably benign 0.15
R0344:Jak2 UTSW 19 29283629 missense probably damaging 1.00
R0398:Jak2 UTSW 19 29282388 missense possibly damaging 0.95
R0408:Jak2 UTSW 19 29286317 missense probably benign 0.38
R0453:Jak2 UTSW 19 29311838 missense probably benign 0.01
R0853:Jak2 UTSW 19 29284926 nonsense probably null
R1180:Jak2 UTSW 19 29282499 missense probably damaging 1.00
R1794:Jak2 UTSW 19 29299557 missense probably benign 0.00
R2247:Jak2 UTSW 19 29283636 missense probably benign 0.01
R3908:Jak2 UTSW 19 29291273 missense probably damaging 1.00
R4705:Jak2 UTSW 19 29294915 missense possibly damaging 0.82
R4744:Jak2 UTSW 19 29262256 missense probably benign 0.02
R4814:Jak2 UTSW 19 29301977 missense probably damaging 1.00
R4903:Jak2 UTSW 19 29275036 missense probably benign 0.03
R5602:Jak2 UTSW 19 29298339 missense probably benign 0.01
R5713:Jak2 UTSW 19 29271393 missense probably damaging 0.96
R5740:Jak2 UTSW 19 29262424 missense possibly damaging 0.81
R5758:Jak2 UTSW 19 29309643 missense probably damaging 1.00
R5966:Jak2 UTSW 19 29283554 missense possibly damaging 0.94
R6285:Jak2 UTSW 19 29295659 missense probably benign 0.35
R6624:Jak2 UTSW 19 29282589 missense probably damaging 0.99
R6649:Jak2 UTSW 19 29288710 missense probably benign 0.00
R6653:Jak2 UTSW 19 29288710 missense probably benign 0.00
X0058:Jak2 UTSW 19 29295711 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCTGGTGTGCCAACAAAAG -3'
(R):5'- CAGGGTCCTAAACTAGGTTGTAAAC -3'

Sequencing Primer
(F):5'- AATTGTTAGGAGGACCCACTGTC -3'
(R):5'- CATGTTACTCATCTTTGGATAATGCC -3'
Posted On2018-05-24