Incidental Mutation 'R6440:Olfr811'
ID518987
Institutional Source Beutler Lab
Gene Symbol Olfr811
Ensembl Gene ENSMUSG00000063173
Gene Nameolfactory receptor 811
SynonymsMOR110-6, GA_x6K02T2PULF-11481207-11480248
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6440 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129800615-129804396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129801968 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 186 (S186P)
Ref Sequence ENSEMBL: ENSMUSP00000149970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076437] [ENSMUST00000215058] [ENSMUST00000217571]
Predicted Effect probably damaging
Transcript: ENSMUST00000076437
AA Change: S186P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075768
Gene: ENSMUSG00000063173
AA Change: S186P

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.1e-51 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215058
AA Change: S186P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216283
Predicted Effect probably damaging
Transcript: ENSMUST00000217571
AA Change: S186P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,794,744 probably null Het
Adgrl3 C T 5: 81,794,494 Q684* probably null Het
Ahi1 T A 10: 20,960,082 probably benign Het
Aox1 A G 1: 58,094,472 T1070A probably damaging Het
B3gnt9 C T 8: 105,253,899 probably null Het
C3ar1 G T 6: 122,850,508 A250E probably damaging Het
Caprin2 A G 6: 148,869,645 F284L probably damaging Het
Cdc25a T C 9: 109,881,498 I90T probably benign Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
Ces2a C T 8: 104,741,322 A528V probably benign Het
Cyp2c70 T C 19: 40,156,806 N402S possibly damaging Het
F3 A G 3: 121,725,037 E50G probably damaging Het
Fli1 A T 9: 32,423,901 S412T probably benign Het
Flt1 T A 5: 147,564,305 D1306V possibly damaging Het
Ggt7 T C 2: 155,498,811 D424G probably damaging Het
Gm5615 T A 9: 36,541,872 M1L probably benign Het
Grm7 A T 6: 111,254,020 N468I probably damaging Het
Htr5a T A 5: 27,850,872 V287E probably damaging Het
Map3k21 T C 8: 125,911,137 V154A probably damaging Het
Muc16 A G 9: 18,641,359 V4546A probably benign Het
Ncbp1 A G 4: 46,147,516 Y121C probably damaging Het
Nckap1l C A 15: 103,471,232 Y315* probably null Het
Ntpcr T A 8: 125,745,242 S64T probably damaging Het
Olfr376 A T 11: 73,375,347 E202D probably benign Het
Olfr869 T C 9: 20,137,194 F26S probably damaging Het
Pde4dip A G 3: 97,767,586 C5R probably damaging Het
Pgap2 T A 7: 102,237,387 probably null Het
Pik3r6 T C 11: 68,533,696 W376R probably benign Het
Plekha2 T C 8: 25,088,397 Y29C probably damaging Het
Pms1 T C 1: 53,195,021 K779E probably damaging Het
Prss16 A G 13: 22,003,160 V98A probably damaging Het
Robo2 C T 16: 73,916,122 D1287N probably benign Het
Sgsm1 A G 5: 113,279,131 probably null Het
Slc40a1 A T 1: 45,925,262 M1K probably null Het
Smo A G 6: 29,756,814 H437R possibly damaging Het
Sult3a1 T C 10: 33,870,202 Y173H possibly damaging Het
Svep1 T A 4: 58,116,555 R898S possibly damaging Het
Synpo2l A G 14: 20,668,176 V7A probably damaging Het
Thsd1 C T 8: 22,258,553 A427V possibly damaging Het
Tnfrsf17 G A 16: 11,319,890 G164S probably benign Het
Zfp235 A G 7: 24,140,615 K153R probably damaging Het
Other mutations in Olfr811
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Olfr811 APN 10 129801907 missense possibly damaging 0.64
IGL01957:Olfr811 APN 10 129802250 missense probably damaging 1.00
IGL02394:Olfr811 APN 10 129802313 missense possibly damaging 0.90
IGL02451:Olfr811 APN 10 129801833 nonsense probably null
IGL03111:Olfr811 APN 10 129802078 missense probably benign 0.00
IGL03369:Olfr811 APN 10 129802471 missense probably damaging 0.99
R0704:Olfr811 UTSW 10 129802303 missense probably benign 0.01
R1393:Olfr811 UTSW 10 129801932 missense probably benign 0.22
R1941:Olfr811 UTSW 10 129802412 missense probably benign 0.00
R1994:Olfr811 UTSW 10 129801661 missense probably damaging 1.00
R3427:Olfr811 UTSW 10 129801851 missense possibly damaging 0.85
R4296:Olfr811 UTSW 10 129802300 missense probably damaging 0.97
R4937:Olfr811 UTSW 10 129802063 missense probably benign 0.31
R5016:Olfr811 UTSW 10 129801793 missense probably benign 0.01
R5615:Olfr811 UTSW 10 129801767 missense probably damaging 1.00
R5662:Olfr811 UTSW 10 129802307 missense possibly damaging 0.83
R5750:Olfr811 UTSW 10 129801620 missense probably benign 0.01
R6109:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6109:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6395:Olfr811 UTSW 10 129802144 missense probably damaging 1.00
R6559:Olfr811 UTSW 10 129801664 missense probably damaging 1.00
R6707:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6708:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6868:Olfr811 UTSW 10 129802168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGACAACAACCATGTGG -3'
(R):5'- GCCATGTCCTATGATCGCTATG -3'

Sequencing Primer
(F):5'- CAACAACCATGTGGGAGGTAC -3'
(R):5'- GATCGCTATGTAGCCATCTGTAGAC -3'
Posted On2018-05-24