Incidental Mutation 'R6440:Cdh9'
ID518992
Institutional Source Beutler Lab
Gene Symbol Cdh9
Ensembl Gene ENSMUSG00000025370
Gene Namecadherin 9
SynonymsT1-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R6440 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location16728756-16857094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16823423 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 164 (T164S)
Ref Sequence ENSEMBL: ENSMUSP00000154022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026432] [ENSMUST00000228307]
Predicted Effect probably benign
Transcript: ENSMUST00000026432
AA Change: T164S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000026432
Gene: ENSMUSG00000025370
AA Change: T164S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 75 156 2.84e-15 SMART
CA 180 265 5.63e-28 SMART
CA 289 381 1.12e-13 SMART
CA 404 485 8.03e-24 SMART
CA 508 595 1.34e-2 SMART
transmembrane domain 613 635 N/A INTRINSIC
Pfam:Cadherin_C 638 782 1.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228307
AA Change: T164S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout results in the formation of abnormal axonal arbors in some retinal type 5 bipolar cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,794,744 probably null Het
Adgrl3 C T 5: 81,794,494 Q684* probably null Het
Ahi1 T A 10: 20,960,082 probably benign Het
Aox1 A G 1: 58,094,472 T1070A probably damaging Het
B3gnt9 C T 8: 105,253,899 probably null Het
C3ar1 G T 6: 122,850,508 A250E probably damaging Het
Caprin2 A G 6: 148,869,645 F284L probably damaging Het
Cdc25a T C 9: 109,881,498 I90T probably benign Het
Ces2a C T 8: 104,741,322 A528V probably benign Het
Cyp2c70 T C 19: 40,156,806 N402S possibly damaging Het
F3 A G 3: 121,725,037 E50G probably damaging Het
Fli1 A T 9: 32,423,901 S412T probably benign Het
Flt1 T A 5: 147,564,305 D1306V possibly damaging Het
Ggt7 T C 2: 155,498,811 D424G probably damaging Het
Gm5615 T A 9: 36,541,872 M1L probably benign Het
Grm7 A T 6: 111,254,020 N468I probably damaging Het
Htr5a T A 5: 27,850,872 V287E probably damaging Het
Map3k21 T C 8: 125,911,137 V154A probably damaging Het
Muc16 A G 9: 18,641,359 V4546A probably benign Het
Ncbp1 A G 4: 46,147,516 Y121C probably damaging Het
Nckap1l C A 15: 103,471,232 Y315* probably null Het
Ntpcr T A 8: 125,745,242 S64T probably damaging Het
Olfr376 A T 11: 73,375,347 E202D probably benign Het
Olfr811 A G 10: 129,801,968 S186P probably damaging Het
Olfr869 T C 9: 20,137,194 F26S probably damaging Het
Pde4dip A G 3: 97,767,586 C5R probably damaging Het
Pgap2 T A 7: 102,237,387 probably null Het
Pik3r6 T C 11: 68,533,696 W376R probably benign Het
Plekha2 T C 8: 25,088,397 Y29C probably damaging Het
Pms1 T C 1: 53,195,021 K779E probably damaging Het
Prss16 A G 13: 22,003,160 V98A probably damaging Het
Robo2 C T 16: 73,916,122 D1287N probably benign Het
Sgsm1 A G 5: 113,279,131 probably null Het
Slc40a1 A T 1: 45,925,262 M1K probably null Het
Smo A G 6: 29,756,814 H437R possibly damaging Het
Sult3a1 T C 10: 33,870,202 Y173H possibly damaging Het
Svep1 T A 4: 58,116,555 R898S possibly damaging Het
Synpo2l A G 14: 20,668,176 V7A probably damaging Het
Thsd1 C T 8: 22,258,553 A427V possibly damaging Het
Tnfrsf17 G A 16: 11,319,890 G164S probably benign Het
Zfp235 A G 7: 24,140,615 K153R probably damaging Het
Other mutations in Cdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cdh9 APN 15 16828362 missense probably damaging 1.00
IGL00555:Cdh9 APN 15 16823406 missense probably damaging 1.00
IGL01110:Cdh9 APN 15 16855926 missense possibly damaging 0.63
IGL01432:Cdh9 APN 15 16830947 missense probably damaging 1.00
IGL01768:Cdh9 APN 15 16778225 missense possibly damaging 0.51
IGL02043:Cdh9 APN 15 16856232 missense probably damaging 1.00
IGL02304:Cdh9 APN 15 16848601 missense probably benign 0.01
IGL02380:Cdh9 APN 15 16856000 missense possibly damaging 0.79
IGL02505:Cdh9 APN 15 16855989 missense probably damaging 1.00
IGL02675:Cdh9 APN 15 16849076 splice site probably null
IGL02679:Cdh9 APN 15 16832230 missense probably damaging 0.97
IGL03288:Cdh9 APN 15 16856049 missense probably damaging 1.00
R0426:Cdh9 UTSW 15 16823454 critical splice donor site probably null
R0726:Cdh9 UTSW 15 16831044 missense probably benign 0.00
R1335:Cdh9 UTSW 15 16850792 missense probably benign 0.00
R1368:Cdh9 UTSW 15 16848482 splice site probably benign
R1766:Cdh9 UTSW 15 16778306 missense probably damaging 1.00
R1916:Cdh9 UTSW 15 16823275 missense probably benign 0.03
R2325:Cdh9 UTSW 15 16778200 missense probably benign
R2424:Cdh9 UTSW 15 16850354 missense probably damaging 1.00
R3104:Cdh9 UTSW 15 16855814 missense probably damaging 1.00
R3837:Cdh9 UTSW 15 16823438 nonsense probably null
R3839:Cdh9 UTSW 15 16823438 nonsense probably null
R4241:Cdh9 UTSW 15 16849079 critical splice acceptor site probably null
R4248:Cdh9 UTSW 15 16850388 missense probably benign 0.00
R4576:Cdh9 UTSW 15 16832239 missense possibly damaging 0.73
R4679:Cdh9 UTSW 15 16850959 missense probably benign
R4896:Cdh9 UTSW 15 16778156 missense probably benign 0.12
R4961:Cdh9 UTSW 15 16850828 missense probably benign
R5050:Cdh9 UTSW 15 16778147 missense probably benign 0.12
R5089:Cdh9 UTSW 15 16778276 missense probably damaging 1.00
R5268:Cdh9 UTSW 15 16851013 missense probably benign
R5567:Cdh9 UTSW 15 16855844 missense probably damaging 1.00
R5646:Cdh9 UTSW 15 16823285 missense probably damaging 1.00
R5894:Cdh9 UTSW 15 16832100 missense possibly damaging 0.47
R6441:Cdh9 UTSW 15 16823423 missense probably benign 0.01
X0062:Cdh9 UTSW 15 16848539 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GAGATATTCACGCTGCAAAGAGAC -3'
(R):5'- GCCATTGGAATCAAACAACTTCTC -3'

Sequencing Primer
(F):5'- TATTCACGCTGCAAAGAGACTAGAC -3'
(R):5'- ATGGAATCACATGGCTGC -3'
Posted On2018-05-24