Incidental Mutation 'R6441:Cdh9'
ID 519031
Institutional Source Beutler Lab
Gene Symbol Cdh9
Ensembl Gene ENSMUSG00000025370
Gene Name cadherin 9
Synonyms T1-cadherin
MMRRC Submission 044579-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R6441 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 16728842-16857180 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 16823509 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 164 (T164S)
Ref Sequence ENSEMBL: ENSMUSP00000154022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026432] [ENSMUST00000228307]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026432
AA Change: T164S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000026432
Gene: ENSMUSG00000025370
AA Change: T164S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 75 156 2.84e-15 SMART
CA 180 265 5.63e-28 SMART
CA 289 381 1.12e-13 SMART
CA 404 485 8.03e-24 SMART
CA 508 595 1.34e-2 SMART
transmembrane domain 613 635 N/A INTRINSIC
Pfam:Cadherin_C 638 782 1.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228307
AA Change: T164S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout results in the formation of abnormal axonal arbors in some retinal type 5 bipolar cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,565,108 (GRCm39) M1047K probably benign Het
Apob A T 12: 8,037,796 (GRCm39) D322V probably damaging Het
Capn12 T A 7: 28,587,427 (GRCm39) C438S probably benign Het
Cdh23 A T 10: 60,143,815 (GRCm39) V2932E probably damaging Het
Cimap1a T C 7: 140,429,161 (GRCm39) S149P probably damaging Het
CN725425 T C 15: 91,120,005 (GRCm39) V42A probably benign Het
Cpb1 T C 3: 20,303,978 (GRCm39) D362G probably damaging Het
Csmd2 C A 4: 128,288,757 (GRCm39) Q1099K probably benign Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Galnt4 A G 10: 98,945,960 (GRCm39) M562V possibly damaging Het
Gtf3c3 T A 1: 54,445,197 (GRCm39) E619V probably benign Het
Gucy2c A T 6: 136,700,759 (GRCm39) M585K probably damaging Het
Hmcn1 A G 1: 150,578,967 (GRCm39) I1993T possibly damaging Het
Lonrf2 T C 1: 38,857,204 (GRCm39) E44G possibly damaging Het
Lrit3 A T 3: 129,594,009 (GRCm39) F189L probably benign Het
Mag T C 7: 30,606,508 (GRCm39) N310D possibly damaging Het
Mccc2 T C 13: 100,091,184 (GRCm39) T151A probably damaging Het
Mybpc1 A T 10: 88,389,139 (GRCm39) S49T probably benign Het
Myh2 A G 11: 67,085,437 (GRCm39) E1787G probably benign Het
Ncapd3 A G 9: 26,974,712 (GRCm39) D728G probably benign Het
Nup37 A G 10: 87,996,799 (GRCm39) E139G probably benign Het
Or52h9 C T 7: 104,202,542 (GRCm39) Q139* probably null Het
Pcdhgb5 A G 18: 37,865,138 (GRCm39) Y311C probably damaging Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Rbm44 A T 1: 91,084,799 (GRCm39) N674Y probably damaging Het
Ryr1 T C 7: 28,759,120 (GRCm39) I3353V possibly damaging Het
Sema3c C T 5: 17,929,130 (GRCm39) T588I possibly damaging Het
Sh2d5 A T 4: 137,986,393 (GRCm39) E372V possibly damaging Het
Slc27a6 C T 18: 58,705,130 (GRCm39) P171S probably benign Het
Slfn3 C T 11: 83,105,740 (GRCm39) T579I probably benign Het
Svil T G 18: 5,049,323 (GRCm39) V287G probably benign Het
Tas1r2 T A 4: 139,396,467 (GRCm39) V602D probably damaging Het
Tln2 A G 9: 67,179,971 (GRCm39) L800P probably damaging Het
Trim31 C A 17: 37,218,683 (GRCm39) Q323K possibly damaging Het
Txndc9 T A 1: 38,029,299 (GRCm39) D183V possibly damaging Het
Vmn2r28 T A 7: 5,491,474 (GRCm39) M258L probably benign Het
Vmn2r75 A T 7: 85,820,784 (GRCm39) I50N probably damaging Het
Zgrf1 A T 3: 127,381,683 (GRCm39) N1161Y possibly damaging Het
Other mutations in Cdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cdh9 APN 15 16,828,448 (GRCm39) missense probably damaging 1.00
IGL00555:Cdh9 APN 15 16,823,492 (GRCm39) missense probably damaging 1.00
IGL01110:Cdh9 APN 15 16,856,012 (GRCm39) missense possibly damaging 0.63
IGL01432:Cdh9 APN 15 16,831,033 (GRCm39) missense probably damaging 1.00
IGL01768:Cdh9 APN 15 16,778,311 (GRCm39) missense possibly damaging 0.51
IGL02043:Cdh9 APN 15 16,856,318 (GRCm39) missense probably damaging 1.00
IGL02304:Cdh9 APN 15 16,848,687 (GRCm39) missense probably benign 0.01
IGL02380:Cdh9 APN 15 16,856,086 (GRCm39) missense possibly damaging 0.79
IGL02505:Cdh9 APN 15 16,856,075 (GRCm39) missense probably damaging 1.00
IGL02675:Cdh9 APN 15 16,849,162 (GRCm39) splice site probably null
IGL02679:Cdh9 APN 15 16,832,316 (GRCm39) missense probably damaging 0.97
IGL03288:Cdh9 APN 15 16,856,135 (GRCm39) missense probably damaging 1.00
R0426:Cdh9 UTSW 15 16,823,540 (GRCm39) critical splice donor site probably null
R0726:Cdh9 UTSW 15 16,831,130 (GRCm39) missense probably benign 0.00
R1335:Cdh9 UTSW 15 16,850,878 (GRCm39) missense probably benign 0.00
R1368:Cdh9 UTSW 15 16,848,568 (GRCm39) splice site probably benign
R1766:Cdh9 UTSW 15 16,778,392 (GRCm39) missense probably damaging 1.00
R1916:Cdh9 UTSW 15 16,823,361 (GRCm39) missense probably benign 0.03
R2325:Cdh9 UTSW 15 16,778,286 (GRCm39) missense probably benign
R2424:Cdh9 UTSW 15 16,850,440 (GRCm39) missense probably damaging 1.00
R3104:Cdh9 UTSW 15 16,855,900 (GRCm39) missense probably damaging 1.00
R3837:Cdh9 UTSW 15 16,823,524 (GRCm39) nonsense probably null
R3839:Cdh9 UTSW 15 16,823,524 (GRCm39) nonsense probably null
R4241:Cdh9 UTSW 15 16,849,165 (GRCm39) critical splice acceptor site probably null
R4248:Cdh9 UTSW 15 16,850,474 (GRCm39) missense probably benign 0.00
R4576:Cdh9 UTSW 15 16,832,325 (GRCm39) missense possibly damaging 0.73
R4679:Cdh9 UTSW 15 16,851,045 (GRCm39) missense probably benign
R4896:Cdh9 UTSW 15 16,778,242 (GRCm39) missense probably benign 0.12
R4961:Cdh9 UTSW 15 16,850,914 (GRCm39) missense probably benign
R5050:Cdh9 UTSW 15 16,778,233 (GRCm39) missense probably benign 0.12
R5089:Cdh9 UTSW 15 16,778,362 (GRCm39) missense probably damaging 1.00
R5268:Cdh9 UTSW 15 16,851,099 (GRCm39) missense probably benign
R5567:Cdh9 UTSW 15 16,855,930 (GRCm39) missense probably damaging 1.00
R5646:Cdh9 UTSW 15 16,823,371 (GRCm39) missense probably damaging 1.00
R5894:Cdh9 UTSW 15 16,832,186 (GRCm39) missense possibly damaging 0.47
R6440:Cdh9 UTSW 15 16,823,509 (GRCm39) missense probably benign 0.01
R7225:Cdh9 UTSW 15 16,856,159 (GRCm39) missense probably damaging 1.00
R7247:Cdh9 UTSW 15 16,778,341 (GRCm39) missense probably damaging 1.00
R7593:Cdh9 UTSW 15 16,823,261 (GRCm39) missense probably damaging 1.00
R7615:Cdh9 UTSW 15 16,856,316 (GRCm39) missense probably damaging 1.00
R7632:Cdh9 UTSW 15 16,851,115 (GRCm39) splice site probably null
R7991:Cdh9 UTSW 15 16,828,489 (GRCm39) missense probably damaging 1.00
R8035:Cdh9 UTSW 15 16,831,152 (GRCm39) missense probably damaging 0.97
R8834:Cdh9 UTSW 15 16,850,964 (GRCm39) missense probably damaging 1.00
R8909:Cdh9 UTSW 15 16,848,610 (GRCm39) missense probably damaging 1.00
R8936:Cdh9 UTSW 15 16,831,162 (GRCm39) critical splice donor site probably null
R8973:Cdh9 UTSW 15 16,831,131 (GRCm39) missense possibly damaging 0.78
R9138:Cdh9 UTSW 15 16,823,273 (GRCm39) missense probably damaging 1.00
R9305:Cdh9 UTSW 15 16,832,138 (GRCm39) missense probably damaging 1.00
RF006:Cdh9 UTSW 15 16,855,916 (GRCm39) missense probably damaging 0.97
X0062:Cdh9 UTSW 15 16,848,625 (GRCm39) missense possibly damaging 0.81
Z1177:Cdh9 UTSW 15 16,850,450 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GATATTCACGCTGCAAAGAGAC -3'
(R):5'- TGCTGCCATTGGAATCAAACAAC -3'

Sequencing Primer
(F):5'- TATTCACGCTGCAAAGAGACTAGAC -3'
(R):5'- TGCCATTGGAATCAAACAACTTCTC -3'
Posted On 2018-05-24