Incidental Mutation 'R6443:Lpin2'
ID 519111
Institutional Source Beutler Lab
Gene Symbol Lpin2
Ensembl Gene ENSMUSG00000024052
Gene Name lipin 2
Synonyms 2610511G02Rik
MMRRC Submission 044581-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.473) question?
Stock # R6443 (G1)
Quality Score 146.008
Status Validated
Chromosome 17
Chromosomal Location 71490527-71556813 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71548663 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 576 (S576P)
Ref Sequence ENSEMBL: ENSMUSP00000119282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126681] [ENSMUST00000129635]
AlphaFold Q99PI5
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125665
Predicted Effect probably benign
Transcript: ENSMUST00000126681
AA Change: S614P

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118610
Gene: ENSMUSG00000024052
AA Change: S614P

DomainStartEndE-ValueType
Pfam:Lipin_N 39 148 1e-47 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Pfam:Lipin_mid 504 596 6.1e-37 PFAM
LNS2 720 876 2.18e-107 SMART
low complexity region 924 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129635
AA Change: S576P

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119282
Gene: ENSMUSG00000024052
AA Change: S576P

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 168 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 360 382 N/A INTRINSIC
LNS2 682 838 2.18e-107 SMART
low complexity region 886 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140150
Predicted Effect unknown
Transcript: ENSMUST00000154507
AA Change: S72P
SMART Domains Protein: ENSMUSP00000127035
Gene: ENSMUSG00000024052
AA Change: S72P

DomainStartEndE-ValueType
Pfam:Lipin_mid 1 55 2.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156565
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mouse studies suggest that this gene functions during normal adipose tissue development and may play a role in human triglyceride metabolism. This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop ataxia, impaired blance, and tremors with age and show altered cerebellar phospholipid composition and anemia. Mice show diet-induced hepatic triglyceride accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,357 (GRCm39) L27P probably damaging Het
Actr6 T C 10: 89,550,733 (GRCm39) N354D probably damaging Het
Apbb1 T A 7: 105,222,970 (GRCm39) N214Y probably damaging Het
Bcar1 A T 8: 112,441,970 (GRCm39) V290E probably damaging Het
Ces1f T A 8: 94,001,993 (GRCm39) Q45L probably benign Het
Ctss A C 3: 95,454,114 (GRCm39) K221T probably benign Het
Dclre1b T A 3: 103,710,504 (GRCm39) N469I possibly damaging Het
Dnah12 C A 14: 26,600,008 (GRCm39) Q3683K probably benign Het
Dnah8 A G 17: 30,990,859 (GRCm39) I3301V probably benign Het
Ephb4 G A 5: 137,358,711 (GRCm39) G298E probably damaging Het
Eya3 T C 4: 132,439,238 (GRCm39) F455L probably damaging Het
Fkbp5 G T 17: 28,648,253 (GRCm39) A112D probably damaging Het
Glud1 T C 14: 34,061,884 (GRCm39) M468T probably benign Het
Gm5114 C A 7: 39,057,141 (GRCm39) R826L possibly damaging Het
Gramd2b G A 18: 56,618,457 (GRCm39) V222I probably benign Het
Kif1b T C 4: 149,277,053 (GRCm39) M1337V probably benign Het
Lrrc1 A G 9: 77,341,314 (GRCm39) F415L probably damaging Het
Mtmr3 A T 11: 4,437,358 (GRCm39) I1032K probably damaging Het
Nr5a1 G A 2: 38,600,442 (GRCm39) T75M probably damaging Het
Nwd1 G A 8: 73,388,994 (GRCm39) V141I possibly damaging Het
Or1e1b-ps1 A T 11: 73,845,918 (GRCm39) Q134L probably benign Het
Or5ar1 T G 2: 85,671,979 (GRCm39) D52A probably damaging Het
Or6c214 C A 10: 129,591,277 (GRCm39) G14V probably damaging Het
Pla1a T C 16: 38,229,949 (GRCm39) probably null Het
Ppp1r36 A G 12: 76,464,413 (GRCm39) S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Homo
Ryr1 A T 7: 28,776,503 (GRCm39) M2204K probably damaging Het
Ryr3 T C 2: 112,506,278 (GRCm39) N3428S possibly damaging Het
Slc6a4 A G 11: 76,914,027 (GRCm39) K526E probably benign Het
Slc9a8 G A 2: 167,276,741 (GRCm39) R78H probably benign Het
Sptbn1 T C 11: 30,089,429 (GRCm39) D611G possibly damaging Het
Sstr2 G A 11: 113,516,080 (GRCm39) probably null Het
Tcf7 G T 11: 52,144,765 (GRCm39) T286N probably benign Het
Txndc5 A G 13: 38,712,179 (GRCm39) M69T possibly damaging Het
Usp48 T A 4: 137,341,074 (GRCm39) V358E probably damaging Het
Vmn2r1 T A 3: 64,012,374 (GRCm39) I745K possibly damaging Het
Zfp354b A G 11: 50,813,581 (GRCm39) I448T possibly damaging Het
Zfp523 A T 17: 28,420,381 (GRCm39) T189S probably damaging Het
Other mutations in Lpin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lpin2 APN 17 71,550,967 (GRCm39) missense probably damaging 1.00
IGL01712:Lpin2 APN 17 71,522,063 (GRCm39) missense probably damaging 1.00
IGL01727:Lpin2 APN 17 71,553,447 (GRCm39) missense probably damaging 1.00
IGL01969:Lpin2 APN 17 71,538,502 (GRCm39) missense probably benign 0.00
IGL02143:Lpin2 APN 17 71,550,921 (GRCm39) missense probably damaging 1.00
IGL02600:Lpin2 APN 17 71,545,693 (GRCm39) missense probably damaging 0.99
IGL02931:Lpin2 APN 17 71,545,678 (GRCm39) missense probably damaging 1.00
aspen UTSW 17 71,550,965 (GRCm39) nonsense probably null
R1570_Lpin2_218 UTSW 17 71,552,176 (GRCm39) nonsense probably null
R0144:Lpin2 UTSW 17 71,532,071 (GRCm39) missense probably damaging 1.00
R0165:Lpin2 UTSW 17 71,553,514 (GRCm39) missense probably damaging 1.00
R0367:Lpin2 UTSW 17 71,522,017 (GRCm39) missense probably damaging 1.00
R0648:Lpin2 UTSW 17 71,536,307 (GRCm39) missense probably benign 0.01
R1564:Lpin2 UTSW 17 71,532,055 (GRCm39) missense probably benign 0.01
R1570:Lpin2 UTSW 17 71,552,176 (GRCm39) nonsense probably null
R1846:Lpin2 UTSW 17 71,532,064 (GRCm39) missense probably benign 0.00
R3607:Lpin2 UTSW 17 71,536,387 (GRCm39) missense probably damaging 1.00
R4006:Lpin2 UTSW 17 71,553,496 (GRCm39) missense probably damaging 1.00
R4526:Lpin2 UTSW 17 71,544,373 (GRCm39) splice site probably null
R4705:Lpin2 UTSW 17 71,539,138 (GRCm39) unclassified probably benign
R4949:Lpin2 UTSW 17 71,538,334 (GRCm39) missense probably damaging 1.00
R4970:Lpin2 UTSW 17 71,538,329 (GRCm39) missense probably damaging 0.98
R5099:Lpin2 UTSW 17 71,550,965 (GRCm39) nonsense probably null
R5100:Lpin2 UTSW 17 71,550,965 (GRCm39) nonsense probably null
R5101:Lpin2 UTSW 17 71,550,965 (GRCm39) nonsense probably null
R5152:Lpin2 UTSW 17 71,552,154 (GRCm39) missense probably damaging 1.00
R5216:Lpin2 UTSW 17 71,549,755 (GRCm39) missense probably damaging 1.00
R5321:Lpin2 UTSW 17 71,553,853 (GRCm39) missense probably damaging 1.00
R5457:Lpin2 UTSW 17 71,550,367 (GRCm39) missense probably damaging 1.00
R5695:Lpin2 UTSW 17 71,551,798 (GRCm39) missense probably damaging 1.00
R5786:Lpin2 UTSW 17 71,537,268 (GRCm39) missense probably benign 0.03
R5869:Lpin2 UTSW 17 71,539,271 (GRCm39) unclassified probably benign
R5894:Lpin2 UTSW 17 71,553,929 (GRCm39) missense probably benign 0.39
R6116:Lpin2 UTSW 17 71,550,925 (GRCm39) missense probably damaging 1.00
R6253:Lpin2 UTSW 17 71,538,264 (GRCm39) missense probably damaging 1.00
R6280:Lpin2 UTSW 17 71,539,243 (GRCm39) unclassified probably benign
R6528:Lpin2 UTSW 17 71,551,000 (GRCm39) missense probably damaging 1.00
R6634:Lpin2 UTSW 17 71,553,413 (GRCm39) missense probably damaging 1.00
R6828:Lpin2 UTSW 17 71,529,123 (GRCm39) missense probably damaging 1.00
R6885:Lpin2 UTSW 17 71,522,145 (GRCm39) missense probably damaging 1.00
R6930:Lpin2 UTSW 17 71,551,786 (GRCm39) missense probably damaging 1.00
R7067:Lpin2 UTSW 17 71,551,853 (GRCm39) missense possibly damaging 0.72
R7583:Lpin2 UTSW 17 71,538,391 (GRCm39) nonsense probably null
R7806:Lpin2 UTSW 17 71,552,166 (GRCm39) missense probably damaging 1.00
R7840:Lpin2 UTSW 17 71,537,269 (GRCm39) missense probably benign 0.14
R8011:Lpin2 UTSW 17 71,537,370 (GRCm39) missense probably benign 0.43
R8553:Lpin2 UTSW 17 71,538,232 (GRCm39) missense probably damaging 1.00
R8879:Lpin2 UTSW 17 71,549,749 (GRCm39) missense probably damaging 1.00
R8947:Lpin2 UTSW 17 71,511,871 (GRCm39) missense probably benign 0.44
R8983:Lpin2 UTSW 17 71,553,962 (GRCm39) missense unknown
R9109:Lpin2 UTSW 17 71,538,516 (GRCm39) critical splice donor site probably null
R9184:Lpin2 UTSW 17 71,540,911 (GRCm39) nonsense probably null
R9242:Lpin2 UTSW 17 71,553,966 (GRCm39) makesense probably null
R9447:Lpin2 UTSW 17 71,539,087 (GRCm39) missense unknown
R9573:Lpin2 UTSW 17 71,538,185 (GRCm39) missense probably benign 0.00
R9603:Lpin2 UTSW 17 71,550,410 (GRCm39) missense probably damaging 1.00
R9666:Lpin2 UTSW 17 71,529,065 (GRCm39) missense probably damaging 1.00
Z1176:Lpin2 UTSW 17 71,532,206 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAAGTTCCCTGCTAGCTCAG -3'
(R):5'- GGAACGGCAGCTCTTAACTAC -3'

Sequencing Primer
(F):5'- TTTGCTTCCTAGCGAGGA -3'
(R):5'- CATTAAGCCACTTAGTATCATGTCTC -3'
Posted On 2018-05-24