Incidental Mutation 'R6444:Ncbp2'
ID519143
Institutional Source Beutler Lab
Gene Symbol Ncbp2
Ensembl Gene ENSMUSG00000022774
Gene Namenuclear cap binding protein subunit 2
Synonyms20kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6444 (G1)
Quality Score217.468
Status Validated
Chromosome16
Chromosomal Location31948513-31961781 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGTCTGGATG to CG at 31956343 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023460] [ENSMUST00000115178] [ENSMUST00000126215] [ENSMUST00000231360]
Predicted Effect probably null
Transcript: ENSMUST00000023460
SMART Domains Protein: ENSMUSP00000023460
Gene: ENSMUSG00000022774

DomainStartEndE-ValueType
RRM 41 114 6.96e-23 SMART
low complexity region 122 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115178
SMART Domains Protein: ENSMUSP00000110832
Gene: ENSMUSG00000022774

DomainStartEndE-ValueType
PDB:3FEY|B 1 103 7e-42 PDB
Blast:RRM 41 61 2e-6 BLAST
SCOP:d1qm9a1 41 97 4e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140965
Predicted Effect probably benign
Transcript: ENSMUST00000231360
Meta Mutation Damage Score 0.648 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein has an RNP domain commonly found in RNA binding proteins, and contains the cap-binding activity. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Ncbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02875:Ncbp2 APN 16 31954153 missense probably damaging 1.00
R1929:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2185:Ncbp2 UTSW 16 31956377 missense probably damaging 1.00
R2270:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2271:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2272:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R6405:Ncbp2 UTSW 16 31956343 frame shift probably null
R6406:Ncbp2 UTSW 16 31956341 frame shift probably null
R6406:Ncbp2 UTSW 16 31956343 frame shift probably null
R6446:Ncbp2 UTSW 16 31956343 frame shift probably null
R6448:Ncbp2 UTSW 16 31956343 frame shift probably null
R6530:Ncbp2 UTSW 16 31956343 frame shift probably null
R6531:Ncbp2 UTSW 16 31956343 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCCCAGAAGTCGTGTTAGACC -3'
(R):5'- ACACTAACAAGCACAAGTTCCTT -3'

Sequencing Primer
(F):5'- CCAGAAGTCGTGTTAGACCAACTTTG -3'
(R):5'- TAACAAGCACAAGTTCCTTACAAAAG -3'
Posted On2018-05-24