Incidental Mutation 'R6445:Krt71'
ID519174
Institutional Source Beutler Lab
Gene Symbol Krt71
Ensembl Gene ENSMUSG00000051879
Gene Namekeratin 71
SynonymsCu, mK6irs, Krt2-6g, mK6irs1, Ca, Cal4
MMRRC Submission 044388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6445 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location101733949-101743109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101740340 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 190 (R190Q)
Ref Sequence ENSEMBL: ENSMUSP00000023710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023710]
Predicted Effect probably benign
Transcript: ENSMUST00000023710
AA Change: R190Q

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023710
Gene: ENSMUSG00000051879
AA Change: R190Q

DomainStartEndE-ValueType
low complexity region 17 55 N/A INTRINSIC
Pfam:Keratin_2_head 59 127 1.6e-20 PFAM
Filament 130 443 1.19e-151 SMART
low complexity region 449 465 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes a protein that is expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mutations in this gene result in waved hair and curly vibrissae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 C A 14: 44,501,274 D43E probably benign Het
Cdh22 T C 2: 165,170,692 I158V probably damaging Het
Cntrl A G 2: 35,162,848 I1676V probably benign Het
Crem T C 18: 3,309,671 Y18C probably benign Het
Cyp2b9 A G 7: 26,186,987 I146V probably benign Het
Efcab14 C A 4: 115,756,471 H205Q possibly damaging Het
Efcab6 T C 15: 83,868,357 Y1437C probably damaging Het
Gm3055 T A 10: 82,109,672 N375K possibly damaging Het
Gm36864 A T 7: 44,237,418 Q245L possibly damaging Het
Gna11 A T 10: 81,533,333 I132N probably damaging Het
Ikzf4 C A 10: 128,636,555 probably null Het
Il9r C T 11: 32,191,000 G346D possibly damaging Het
Mfsd8 T C 3: 40,837,118 I54V probably damaging Het
Nktr G T 9: 121,748,414 probably benign Het
Olfr199 A T 16: 59,216,109 F168Y probably damaging Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Peli2 T C 14: 48,256,448 S376P possibly damaging Het
Pik3r2 C T 8: 70,772,026 A202T probably benign Het
Pms1 A T 1: 53,192,194 I832K possibly damaging Het
Reln T C 5: 21,919,214 K2765E probably benign Het
Rp1 A T 1: 4,226,617 N744K unknown Het
Smcr8 T C 11: 60,779,015 Y330H possibly damaging Het
Sned1 A T 1: 93,283,596 R281S possibly damaging Het
Synm A G 7: 67,733,645 V1423A probably benign Het
Syt10 G A 15: 89,814,268 T291I probably damaging Het
Ttn T C 2: 76,914,536 probably benign Het
Wdr3 T C 3: 100,156,403 T186A possibly damaging Het
Zfp451 A C 1: 33,773,011 D874E probably damaging Het
Other mutations in Krt71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Krt71 APN 15 101736674 missense probably damaging 1.00
IGL03076:Krt71 APN 15 101734597 missense probably benign 0.00
IGL03390:Krt71 APN 15 101734552 missense possibly damaging 0.93
R0040:Krt71 UTSW 15 101738433 missense possibly damaging 0.90
R0040:Krt71 UTSW 15 101738433 missense possibly damaging 0.90
R0041:Krt71 UTSW 15 101739318 missense probably damaging 1.00
R0153:Krt71 UTSW 15 101734706 missense possibly damaging 0.65
R0376:Krt71 UTSW 15 101738070 missense probably damaging 1.00
R0932:Krt71 UTSW 15 101736760 missense probably benign 0.20
R1263:Krt71 UTSW 15 101735466 missense probably damaging 1.00
R1646:Krt71 UTSW 15 101738764 splice site probably null
R1796:Krt71 UTSW 15 101742880 missense possibly damaging 0.68
R1954:Krt71 UTSW 15 101735466 nonsense probably null
R3001:Krt71 UTSW 15 101740471 splice site probably benign
R3793:Krt71 UTSW 15 101742910 missense probably damaging 1.00
R4236:Krt71 UTSW 15 101734694 missense probably benign 0.09
R4751:Krt71 UTSW 15 101735466 missense probably damaging 1.00
R7034:Krt71 UTSW 15 101738337 missense probably benign 0.41
R7036:Krt71 UTSW 15 101738337 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACTCTACTTGGTATGGCCTCGG -3'
(R):5'- ATGGCTTTGCATGTCAAGTG -3'

Sequencing Primer
(F):5'- TATGGCCTCGGACATACGAACTC -3'
(R):5'- TGCATGTCAAGTGTGATGAATTC -3'
Posted On2018-05-24