Incidental Mutation 'R6446:Dut'
ID519178
Institutional Source Beutler Lab
Gene Symbol Dut
Ensembl Gene ENSMUSG00000027203
Gene Namedeoxyuridine triphosphatase
SynonymsDutp, dUTPase, 5031412I06Rik, D2Bwg0749e, 5133400F09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location125247190-125258608 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 125251019 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051605] [ENSMUST00000082122]
Predicted Effect probably null
Transcript: ENSMUST00000051605
SMART Domains Protein: ENSMUSP00000057854
Gene: ENSMUSG00000027203

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:dUTPase 31 160 1.2e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000082122
SMART Domains Protein: ENSMUSP00000080767
Gene: ENSMUSG00000027203

DomainStartEndE-ValueType
low complexity region 3 56 N/A INTRINSIC
Pfam:dUTPase 69 198 1.6e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133211
Meta Mutation Damage Score 0.502 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential enzyme of nucleotide metabolism. The encoded protein forms a ubiquitous, homotetrameric enzyme that hydrolyzes dUTP to dUMP and pyrophosphate. This reaction serves two cellular purposes: providing a precursor (dUMP) for the synthesis of thymine nucleotides needed for DNA replication, and limiting intracellular pools of dUTP. Elevated levels of dUTP lead to increased incorporation of uracil into DNA, which induces extensive excision repair mediated by uracil glycosylase. This repair process, resulting in the removal and reincorporation of dUTP, is self-defeating and leads to DNA fragmentation and cell death. Alternative splicing of this gene leads to different isoforms that localize to either the mitochondrion or nucleus. A related pseudogene is located on chromosome 19. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Dut
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0268:Dut UTSW 2 125257091 missense probably damaging 1.00
R1083:Dut UTSW 2 125247828 frame shift probably null
R6607:Dut UTSW 2 125256867 missense probably damaging 1.00
R6888:Dut UTSW 2 125257124 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGCAAGTCATGTGGTCGG -3'
(R):5'- TAGCCACACAGAAGGTTTTCC -3'

Sequencing Primer
(F):5'- GGCTATACAGAGAAACCCTGTCTTG -3'
(R):5'- TGCAGTAAGGTGTAGATTATCAGGAC -3'
Posted On2018-05-24