Incidental Mutation 'R6446:Mtmr11'
ID519180
Institutional Source Beutler Lab
Gene Symbol Mtmr11
Ensembl Gene ENSMUSG00000045934
Gene Namemyotubularin related protein 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location96162004-96171718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96171188 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 687 (S687C)
Ref Sequence ENSEMBL: ENSMUSP00000062341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054356] [ENSMUST00000076372] [ENSMUST00000129925]
Predicted Effect probably benign
Transcript: ENSMUST00000054356
AA Change: S687C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062341
Gene: ENSMUSG00000045934
AA Change: S687C

DomainStartEndE-ValueType
Pfam:Myotub-related 191 323 1.7e-12 PFAM
Pfam:Myotub-related 312 488 1.3e-44 PFAM
Pfam:3-PAP 550 683 2.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076372
SMART Domains Protein: ENSMUSP00000075709
Gene: ENSMUSG00000068856

DomainStartEndE-ValueType
RRM 14 87 1.46e-25 SMART
RRM 101 175 5.07e-25 SMART
low complexity region 214 307 N/A INTRINSIC
low complexity region 310 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129925
SMART Domains Protein: ENSMUSP00000118258
Gene: ENSMUSG00000045934

DomainStartEndE-ValueType
Pfam:Myotub-related 162 264 4.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199721
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Mtmr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02539:Mtmr11 APN 3 96164991 intron probably benign
R1017:Mtmr11 UTSW 3 96164477 missense probably damaging 1.00
R1589:Mtmr11 UTSW 3 96168113 missense probably benign 0.16
R1836:Mtmr11 UTSW 3 96164786 missense probably damaging 0.98
R2264:Mtmr11 UTSW 3 96169097 missense possibly damaging 0.53
R3623:Mtmr11 UTSW 3 96165266 missense probably damaging 1.00
R4195:Mtmr11 UTSW 3 96167891 splice site probably benign
R4243:Mtmr11 UTSW 3 96168077 missense probably damaging 1.00
R4245:Mtmr11 UTSW 3 96168077 missense probably damaging 1.00
R4414:Mtmr11 UTSW 3 96167891 splice site probably benign
R4417:Mtmr11 UTSW 3 96167891 splice site probably benign
R4461:Mtmr11 UTSW 3 96167891 splice site probably benign
R4468:Mtmr11 UTSW 3 96167891 splice site probably benign
R4963:Mtmr11 UTSW 3 96163250 intron probably benign
R5134:Mtmr11 UTSW 3 96169907 missense probably damaging 1.00
R5154:Mtmr11 UTSW 3 96164319 missense probably benign 0.03
R5508:Mtmr11 UTSW 3 96163767 missense probably damaging 1.00
R5821:Mtmr11 UTSW 3 96167869 missense possibly damaging 0.91
R5868:Mtmr11 UTSW 3 96171202 missense possibly damaging 0.65
R5991:Mtmr11 UTSW 3 96168589 unclassified probably null
R6084:Mtmr11 UTSW 3 96168084 missense probably damaging 0.99
R6354:Mtmr11 UTSW 3 96168676 missense probably benign 0.07
R6821:Mtmr11 UTSW 3 96170407 missense probably benign
R7033:Mtmr11 UTSW 3 96169946 missense probably damaging 1.00
R7312:Mtmr11 UTSW 3 96164538 missense possibly damaging 0.68
X0019:Mtmr11 UTSW 3 96164492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCTAGAAGTACCAAGGATCTTAG -3'
(R):5'- TGCTACAGAAACGGGCCTTC -3'

Sequencing Primer
(F):5'- CTGAGTTTGAGCTAGTTCCAGAACAG -3'
(R):5'- AACGGGCCTTCTAAGTGAACTCTG -3'
Posted On2018-05-24