Incidental Mutation 'R6446:Sh3glb1'
List |< first << previous [record 33 of 38] next >> last >|
ID519182
Institutional Source Beutler Lab
Gene Symbol Sh3glb1
Ensembl Gene ENSMUSG00000037062
Gene NameSH3-domain GRB2-like B1 (endophilin)
SynonymsBif-1, Endophilin B1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location144683678-144720335 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144705605 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 13 (K13E)
Ref Sequence ENSEMBL: ENSMUSP00000142626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163279] [ENSMUST00000198254] [ENSMUST00000199531] [ENSMUST00000199854] [ENSMUST00000200532]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163279
AA Change: K160E

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129800
Gene: ENSMUSG00000037062
AA Change: K160E

DomainStartEndE-ValueType
BAR 10 254 6.4e-89 SMART
SH3 308 365 1.57e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000198254
AA Change: K160E

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143312
Gene: ENSMUSG00000037062
AA Change: K160E

DomainStartEndE-ValueType
BAR 10 275 1.12e-88 SMART
SH3 329 386 1.57e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000199531
AA Change: K160E

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143433
Gene: ENSMUSG00000037062
AA Change: K160E

DomainStartEndE-ValueType
BAR 10 254 1.7e-91 SMART
SH3 308 355 6.4e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199854
AA Change: K160E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142716
Gene: ENSMUSG00000037062
AA Change: K160E

DomainStartEndE-ValueType
BAR 10 283 1.8e-90 SMART
SH3 337 394 9.5e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200532
AA Change: K13E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142626
Gene: ENSMUSG00000037062
AA Change: K13E

DomainStartEndE-ValueType
Pfam:BAR 1 144 8.2e-28 PFAM
Pfam:BAR_2 1 144 1.8e-6 PFAM
Blast:BAR 152 194 2e-7 BLAST
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a SRC homology 3 domain-containing protein. The encoded protein interacts with the proapoptotic member of the Bcl-2 family, Bcl-2-associated X protein (Bax) and may be involved in regulating apoptotic signaling pathways. This protein may also be involved in maintaining mitochondrial morphology. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutation of this gene results in delayed apoptosis of embryonic fibroblasts in response to serum withdrawal or treatment with a mitochondrial stress inducer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Sh3glb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02541:Sh3glb1 APN 3 144720040 missense probably damaging 0.99
R1766:Sh3glb1 UTSW 3 144712685 missense probably damaging 1.00
R4534:Sh3glb1 UTSW 3 144699863 missense possibly damaging 0.56
R5456:Sh3glb1 UTSW 3 144709353 missense probably benign 0.01
R5748:Sh3glb1 UTSW 3 144712649 missense probably damaging 0.98
R5902:Sh3glb1 UTSW 3 144712670 missense possibly damaging 0.90
R6167:Sh3glb1 UTSW 3 144691903 missense probably damaging 1.00
R6310:Sh3glb1 UTSW 3 144697467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACACTGTTCTGTAATCTGC -3'
(R):5'- CCTAGCATGATAAAATTGGGTTCAG -3'

Sequencing Primer
(F):5'- ACACTGTTCTGTAATCTGCATTTTG -3'
(R):5'- TCAGTAGGATGAAATCTGATACATGG -3'
Posted On2018-05-24