Incidental Mutation 'R6446:Cdkl2'
ID519183
Institutional Source Beutler Lab
Gene Symbol Cdkl2
Ensembl Gene ENSMUSG00000029403
Gene Namecyclin-dependent kinase-like 2 (CDC2-related kinase)
Synonyms5330436L21Rik, KKIAMRE, Kkm
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location92006074-92043883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92033217 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 188 (I188F)
Ref Sequence ENSEMBL: ENSMUSP00000108768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069937] [ENSMUST00000086978] [ENSMUST00000113140] [ENSMUST00000113143]
Predicted Effect probably damaging
Transcript: ENSMUST00000069937
AA Change: I188F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063617
Gene: ENSMUSG00000029403
AA Change: I188F

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086978
AA Change: I188F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084199
Gene: ENSMUSG00000029403
AA Change: I188F

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113140
AA Change: I188F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108765
Gene: ENSMUSG00000029403
AA Change: I188F

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113143
AA Change: I188F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108768
Gene: ENSMUSG00000029403
AA Change: I188F

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201357
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a large family of CDC2-related serine/threonine protein kinases. It accumulates primarily in the cytoplasm, with lower levels in the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Cdkl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Cdkl2 APN 5 92017377 splice site probably null
IGL02481:Cdkl2 APN 5 92037271 missense probably damaging 1.00
IGL02943:Cdkl2 APN 5 92037244 missense possibly damaging 0.81
IGL03187:Cdkl2 APN 5 92017380 critical splice donor site probably null
IGL03251:Cdkl2 APN 5 92033726 missense probably damaging 1.00
R0422:Cdkl2 UTSW 5 92020312 missense probably benign 0.02
R0616:Cdkl2 UTSW 5 92009004 missense probably benign 0.12
R0764:Cdkl2 UTSW 5 92020277 missense probably benign 0.00
R1023:Cdkl2 UTSW 5 92039286 missense possibly damaging 0.58
R2338:Cdkl2 UTSW 5 92033679 missense possibly damaging 0.92
R2497:Cdkl2 UTSW 5 92008998 missense probably benign 0.44
R3926:Cdkl2 UTSW 5 92033139 missense possibly damaging 0.62
R4444:Cdkl2 UTSW 5 92020309 missense probably benign 0.10
R4445:Cdkl2 UTSW 5 92020309 missense probably benign 0.10
R4446:Cdkl2 UTSW 5 92020309 missense probably benign 0.10
R4647:Cdkl2 UTSW 5 92017213 missense probably damaging 0.99
R4664:Cdkl2 UTSW 5 92037265 missense probably damaging 0.99
R5478:Cdkl2 UTSW 5 92039249 nonsense probably null
R5636:Cdkl2 UTSW 5 92033742 missense probably benign 0.01
R7051:Cdkl2 UTSW 5 92033225 missense probably damaging 0.99
R7096:Cdkl2 UTSW 5 92033184 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGATCAGCCTTGCTAGAGG -3'
(R):5'- GTCGTAATGATCCCTAGTGCTTTC -3'

Sequencing Primer
(F):5'- ATCAGCCTTGCTAGAGGGTCTG -3'
(R):5'- CCTAGTGCTTTCTCCTTGAAAAC -3'
Posted On2018-05-24