Incidental Mutation 'R6446:Hpse'
ID519184
Institutional Source Beutler Lab
Gene Symbol Hpse
Ensembl Gene ENSMUSG00000035273
Gene Nameheparanase
SynonymsHpa
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location100679484-100719716 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 100695569 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 246 (Q246*)
Ref Sequence ENSEMBL: ENSMUSP00000108529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045617] [ENSMUST00000112908]
Predicted Effect probably null
Transcript: ENSMUST00000045617
AA Change: Q246*
SMART Domains Protein: ENSMUSP00000044072
Gene: ENSMUSG00000035273
AA Change: Q246*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Glyco_hydro_79n 132 362 1.8e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112908
AA Change: Q246*
SMART Domains Protein: ENSMUSP00000108529
Gene: ENSMUSG00000035273
AA Change: Q246*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Glyco_hydro_79n 144 362 1.2e-24 PFAM
Meta Mutation Damage Score 0.6044 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This gene encodes an endoglucuronidase enzyme that plays an important role in tumor invasion and metastasis. The encoded preproprotein undergoes proteolytic processing to generate an active heterodimeric enzyme that cleaves the heparan sulfate proteoglycans associated with the cell surface and extracellular matrix. Mice lacking the encoded protein do not show any prominent pathological alterations under normal conditions but fail to develop albuminuria and renal damage in response to drug-induced diabetes. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit precocious mammry gland development, increased angiogenesis and increased neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Hpse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Hpse APN 5 100691330 missense possibly damaging 0.89
IGL00743:Hpse APN 5 100698999 missense probably benign 0.01
IGL02377:Hpse APN 5 100691333 missense probably damaging 1.00
R0082:Hpse UTSW 5 100692262 missense possibly damaging 0.93
R0194:Hpse UTSW 5 100719512 missense probably benign
R1974:Hpse UTSW 5 100692238 missense probably damaging 1.00
R2065:Hpse UTSW 5 100698931 missense probably damaging 1.00
R2152:Hpse UTSW 5 100691403 nonsense probably null
R2405:Hpse UTSW 5 100708771 missense possibly damaging 0.78
R3791:Hpse UTSW 5 100692238 missense probably damaging 1.00
R5127:Hpse UTSW 5 100719537 missense unknown
R5147:Hpse UTSW 5 100719509 missense probably benign 0.00
R5385:Hpse UTSW 5 100708724 nonsense probably null
R7009:Hpse UTSW 5 100692279 missense probably benign 0.01
R7186:Hpse UTSW 5 100695529 missense probably damaging 1.00
X0022:Hpse UTSW 5 100691378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGTGGGTAATTTTAAGTACACAT -3'
(R):5'- TGTAATTTGAGAAATGCTTGTTGC -3'

Sequencing Primer
(F):5'- TGCTAAACAGAGAAACCCTGTCTTG -3'
(R):5'- ATTTGAGAAATGCTTGTTGCTGTATG -3'
Posted On2018-05-24