Incidental Mutation 'R6446:Helq'
ID519185
Institutional Source Beutler Lab
Gene Symbol Helq
Ensembl Gene ENSMUSG00000035266
Gene Namehelicase, POLQ-like
SynonymsD430018E21Rik, Hel308
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location100762145-100798598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100768384 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 907 (N907K)
Ref Sequence ENSEMBL: ENSMUSP00000041599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044684]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044684
AA Change: N907K

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041599
Gene: ENSMUSG00000035266
AA Change: N907K

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
DEXDc 291 486 3.05e-17 SMART
HELICc 585 671 2.54e-14 SMART
low complexity region 812 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 1029 1042 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133845
SMART Domains Protein: ENSMUSP00000116470
Gene: ENSMUSG00000035266

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
DEXDc 290 485 3.05e-17 SMART
HELICc 584 670 2.54e-14 SMART
low complexity region 811 826 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139203
Predicted Effect probably benign
Transcript: ENSMUST00000155362
SMART Domains Protein: ENSMUSP00000120806
Gene: ENSMUSG00000035266

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HEL308 is a single-stranded DNA-dependent ATPase and DNA helicase (Marini and Wood, 2002 [PubMed 11751861]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced fertility and increased incident of tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Helq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Helq APN 5 100765082 unclassified probably benign
IGL02142:Helq APN 5 100783094 missense probably benign 0.01
IGL02172:Helq APN 5 100790147 missense probably damaging 1.00
IGL02234:Helq APN 5 100796470 missense possibly damaging 0.93
IGL03086:Helq APN 5 100796927 missense possibly damaging 0.60
R0083:Helq UTSW 5 100768368 nonsense probably null
R0108:Helq UTSW 5 100768368 nonsense probably null
R0276:Helq UTSW 5 100790147 missense probably damaging 1.00
R0359:Helq UTSW 5 100790200 missense probably benign 0.01
R0383:Helq UTSW 5 100779165 missense probably benign 0.28
R0554:Helq UTSW 5 100790200 missense probably benign 0.01
R1289:Helq UTSW 5 100796464 missense probably damaging 1.00
R1682:Helq UTSW 5 100792813 missense probably benign 0.41
R1800:Helq UTSW 5 100774124 missense probably benign 0.34
R1809:Helq UTSW 5 100773954 missense probably damaging 0.97
R1838:Helq UTSW 5 100771879 nonsense probably null
R3086:Helq UTSW 5 100773992 missense probably benign
R3439:Helq UTSW 5 100798304 missense probably damaging 0.97
R3735:Helq UTSW 5 100790188 missense possibly damaging 0.64
R3736:Helq UTSW 5 100790188 missense possibly damaging 0.64
R4172:Helq UTSW 5 100771847 missense probably benign 0.03
R4835:Helq UTSW 5 100774163 missense possibly damaging 0.82
R4855:Helq UTSW 5 100783159 missense possibly damaging 0.89
R4908:Helq UTSW 5 100762641 splice site probably null
R4973:Helq UTSW 5 100792871 intron probably benign
R5561:Helq UTSW 5 100787050 missense probably benign 0.06
R5583:Helq UTSW 5 100762593 missense probably damaging 0.99
R5608:Helq UTSW 5 100790219 missense probably damaging 1.00
R5682:Helq UTSW 5 100785304 missense probably benign 0.04
R5875:Helq UTSW 5 100796470 missense probably damaging 1.00
R6302:Helq UTSW 5 100798439 missense probably damaging 0.96
R6344:Helq UTSW 5 100766728 missense probably benign 0.27
R6825:Helq UTSW 5 100792695 missense probably damaging 1.00
R7260:Helq UTSW 5 100791927 missense probably damaging 1.00
R7323:Helq UTSW 5 100783185 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGCTCCGAAAGAACACAGTG -3'
(R):5'- GTGAAGGTTCGATCTGCTCTC -3'

Sequencing Primer
(F):5'- CACAGTGACTCAGCAGGG -3'
(R):5'- GAAGGTTCGATCTGCTCTCCTCTG -3'
Posted On2018-05-24