Incidental Mutation 'R6446:Olfr297'
ID519193
Institutional Source Beutler Lab
Gene Symbol Olfr297
Ensembl Gene ENSMUSG00000057067
Gene Nameolfactory receptor 297
SynonymsGA_x6K02T2NHDJ-9587747-9586815, MOR220-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86519968-86528497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86527102 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 115 (I115N)
Ref Sequence ENSEMBL: ENSMUSP00000134371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071112] [ENSMUST00000172965]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071112
AA Change: I115N

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132942
Gene: ENSMUSG00000057067
AA Change: I115N

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.9e-45 PFAM
Pfam:7tm_1 39 288 1.4e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172965
AA Change: I115N

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134371
Gene: ENSMUSG00000057067
AA Change: I115N

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.2e-46 PFAM
Pfam:7tm_1 39 288 2e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Olfr297
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Olfr297 APN 7 86526778 missense probably benign 0.10
IGL01823:Olfr297 APN 7 86527041 missense probably damaging 1.00
PIT4378001:Olfr297 UTSW 7 86527098 missense possibly damaging 0.50
R0304:Olfr297 UTSW 7 86526987 missense probably damaging 1.00
R0737:Olfr297 UTSW 7 86526987 missense probably damaging 1.00
R2177:Olfr297 UTSW 7 86527662 missense probably benign 0.01
R2436:Olfr297 UTSW 7 86527383 missense probably damaging 0.99
R4289:Olfr297 UTSW 7 86527054 missense probably damaging 1.00
R4639:Olfr297 UTSW 7 86526761 start codon destroyed probably null 1.00
R5202:Olfr297 UTSW 7 86527116 missense probably damaging 1.00
R5782:Olfr297 UTSW 7 86527213 missense probably damaging 0.98
R6615:Olfr297 UTSW 7 86526912 missense probably benign 0.06
R6920:Olfr297 UTSW 7 86527314 missense probably benign 0.00
R7150:Olfr297 UTSW 7 86527114 missense probably damaging 1.00
R7309:Olfr297 UTSW 7 86527141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGACCAGACCCTGAACAC -3'
(R):5'- GTAAGCCTCAGCAAAGCAGG -3'

Sequencing Primer
(F):5'- GAACACACCCATGTACTTCTTCC -3'
(R):5'- GAACTGAGGAACTACATTTGAGTGAC -3'
Posted On2018-05-24